WARNING: This summary was generated by AI. MIR148B is a type of microRNA that has been observed in serum samples of breast cancer patients, where its concentration was generally found to be lower compared to controls [PMC9967215]. Specifically, the ratio of MIR148B was reported to be down in two instances, indicating a potential role in the pathogenesis or progression of breast cancer [PMC9967215]. Additionally, MIR148B is involved in the regulation of ACVR1/Alk-2 expression, which is a common trait among most microRNAs that were downregulated in the study [PMC3515447]. This regulatory function aligns with the broader understanding that microRNAs can act as oncogenes or tumor suppressors by modulating gene expression [PMC3515447].
caagcac uu a U A CA guggc
ga agc uuugaggugAAGUUCUGU AU CACU GGCu u
|| ||| |||||||||||||||||| || |||| |||| c
cu ucg aagcucUGUUUCAAGACA UA GUGA CUga u
-----au -u a C C -- aaguc
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004699 |
| Description | Homo sapiens hsa-miR-148b-5p mature miRNA |
| Sequence | 25 - AAGUUCUGUUAUACACUCAGGC - 46 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000759 |
| Description | Homo sapiens hsa-miR-148b-3p mature miRNA |
| Sequence | 63 - UCAGUGCAUCACAGAACUUUGU - 84 |
| Evidence |
experimental
cloned [3-4] |
| Database links |
|
| Predicted targets |
|
|