Stem-loop hsa-mir-331

Accession

MI0000812

Symbol

HGNC: MIR331

Description

Homo sapiens hsa-mir-331 precursor miRNA mir-331

Gene
family

RF00769; mir-331

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR331 is a microRNA that has been found to repress genes encoding zinc binding proteins [PMC5447065]. It has also been implicated in various biological processes and diseases. For example, MIR331 has been shown to target E2F1, p21, and cyclin D, suggesting its role as a tumor suppressor [PMC5513062]. In chronic lymphocytic leukemia (CLL), high expression of MIR331 is hypothesized to target SOCS1, a gene involved in cell survival and proliferation [PMC6183594]. In addition, MIR331 has been identified as one of the differentially expressed non-coding RNAs (ncRNAs) associated with overall survival in osteosarcoma [PMC8648947]. It is also involved in the 3'-UTR processing of other microRNAs such as MIR1191 and MIR7673 [PMC6515687]. Furthermore, MIR331 is one of the genes involved in the process of osthole alleviating neuropathic pain through the metabolic pathway and gut microbiota [PMC8860327]. It has also been identified as one of the genes located at GWA SNP risk loci associated with various diseases including endometriosis and prostate cancer [PMC5458088]. Overall, MIR331 plays a role in various biological processes and diseases through its interactions with different target genes and microRNAs.

Literature search

78 open access papers mention hsa-mir-331
(231 sentences)

Sequence

104961 reads, 805 reads per million, 126 experiments

gaguuugguuuuguuuggguuuguuCUAGGUAUGGUCCCAGGGAUCCcagaucaaaccagGCCCCUGGGCCUAUCCUAGAAccaaccuaagcuc
............(((((((((.((((((((.((((.(((((((...((...........)).))))))).)))))))))))).)))))))))..

Structure

gaguuugguuuu         u        U    U       AUC  agau 
            guuuggguu guuCUAGG AUGG CCCAGGG   Cc    c
            ||||||||| |||||||| |||| |||||||   ||    a
            cgaauccaa cAAGAUCC UAUC GGGUCCC   Gg    a
----------cu         c        -    C       --C  acca 

Annotation confidence Not enough data

Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3].

Genome context

chr12: 95308420-95308513 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-mir-331

Mature hsa-miR-331-5p

• Accession: MIMAT0004700
• Description: Homo sapiens hsa-miR-331-5p mature miRNA
• Sequence: 26 - CUAGGUAUGGUCCCAGGGAUCC - 47
• Evidence: experimental ; cloned [3]

Mature hsa-miR-331-3p

• Accession: MIMAT0000760
• Description: Homo sapiens hsa-miR-331-3p mature miRNA
• Sequence: 61 - GCCCCUGGGCCUAUCCUAGAA - 81
• Evidence: experimental ; cloned [3-4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 15634332
   New human and mouse microRNA genes found by homology search
   "Weber MJ"
   "FEBS J (2005) 272:59-73


4. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365