miRBase entry: hsa-mir-324

Stem-loop hsa-mir-324


Accession
MI0000813
Symbol
HGNC: MIR324
Description
Homo sapiens hsa-mir-324 precursor miRNA mir-324
Gene
family?
RF03479; mir-324

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR324 is a microRNA that has been associated with adrenergic trans-differentiation of sensory nerves in mouse models of oral cancer [PMC7396546]. The regulatory regions of murine MIR324 have been found to contain a TonE consensus sequence, suggesting that TonEBP may regulate the expression of this microRNA [PMC9104010]. The removal of MIR324 in mice has been shown to result in hippocampal hyperexcitability and an increase in epilepsy-associated events [PMC8129095]. Additionally, the removal of MIR324 has been found to significantly alter the expression of genes in the hippocampus and neocortex [PMC8129095]. Mice lacking MIR324 have also been found to exhibit an increase in hyperexcitable epilepsy-related events [PMC8129095]. The expression levels of MIR324 have been shown to be altered with age and sex, with many key miRNAs, including miR-34a, being upregulated in the ageing brain and showing differential expression by sex [PMC8129095]. Furthermore, high expression levels of MIR324 have been associated with better prognosis in breast cancer patients [PMC8648947]. It has also been suggested that further investigation into the downstream effects of MIR324 removal may reveal novel pathways involved in certain conditions such as ISOD and PPDE [PMC8129095]. Overall, understanding the role and regulation of MIR324 may provide insights into various biological processes and potential therapeutic targets.

Literature search
65 open access papers mention hsa-mir-324
(212 sentences)

Sequence

51358 reads, 516 reads per million, 148 experiments
cugacuaugccucccCGCAUCCCCUAGGGCAUUGGUGuaaagcuggagaCCCACUGCCCCAGGUGCUGCUGGggguuguaguc
..(((((((.(((((.(((.(.(((.(((((.(((.((..........))))).))))).))).).))).))))).)))))))

Structure
cu       c     C   U C   A     U   U  aaag 
  gacuaug cuccc GCA C CCU GGGCA UGG Gu    c
  ||||||| ||||| ||| | ||| ||||| ||| ||     
  cugaugu gggGG CGU G GGA CCCGU ACC Ca    u
--       u     U   C U   C     C   -  gagg 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr17: 7223297-7223379 [-]

Database links

Mature hsa-miR-324-5p

Accession MIMAT0000761
Description Homo sapiens hsa-miR-324-5p mature miRNA
Sequence 16 - CGCAUCCCCUAGGGCAUUGGUG - 37
Evidence experimental
cloned [4-5]
Database links
Predicted targets

Mature hsa-miR-324-3p

Accession MIMAT0000762
Description Homo sapiens hsa-miR-324-3p mature miRNA
Sequence 50 - CCCACUGCCCCAGGUGCUGCUGG - 72
Evidence experimental
cloned [3-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  4. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  5. PubMed ID: 15800047
    Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells
    "Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR"
    "Proc Natl Acad Sci U S A (2005) 102:5570-5575