MIR324 is a microRNA that has been associated with adrenergic trans-differentiation of sensory nerves in mouse models of oral cancer [PMC7396546]. The regulatory regions of murine MIR324 have been found to contain a TonE consensus sequence, suggesting that TonEBP may regulate the expression of this microRNA [PMC9104010]. The removal of MIR324 in mice has been shown to result in hippocampal hyperexcitability and an increase in epilepsy-associated events [PMC8129095]. Additionally, the removal of MIR324 has been found to significantly alter the expression of genes in the hippocampus and neocortex [PMC8129095]. Mice lacking MIR324 have also been found to exhibit an increase in hyperexcitable epilepsy-related events [PMC8129095]. The expression levels of MIR324 have been shown to be altered with age and sex, with many key miRNAs, including miR-34a, being upregulated in the ageing brain and showing differential expression by sex [PMC8129095]. Furthermore, high expression levels of MIR324 have been associated with better prognosis in breast cancer patients [PMC8648947]. It has also been suggested that further investigation into the downstream effects of MIR324 removal may reveal novel pathways involved in certain conditions such as ISOD and PPDE [PMC8129095]. Overall, understanding the role and regulation of MIR324 may provide insights into various biological processes and potential therapeutic targets.
cu c C U C A U U aaag gacuaug cuccc GCA C CCU GGGCA UGG Gu c ||||||| ||||| ||| | ||| ||||| ||| || cugaugu gggGG CGU G GGA CCCGU ACC Ca u -- u U C U C C - gagg
Accession | MIMAT0000761 |
Description | Homo sapiens hsa-miR-324-5p mature miRNA |
Sequence | 16 - CGCAUCCCCUAGGGCAUUGGUG - 37 |
Evidence |
experimental
cloned [4-5] |
Database links | |
Predicted targets |
Accession | MIMAT0000762 |
Description | Homo sapiens hsa-miR-324-3p mature miRNA |
Sequence | 50 - CCCACUGCCCCAGGUGCUGCUGG - 72 |
Evidence |
experimental
cloned [3-5] |
Database links | |
Predicted targets |
|