miRBase entry: hsa-mir-324

Stem-loop hsa-mir-324


Accession
MI0000813
Symbol
HGNC: MIR324
Description
Homo sapiens hsa-mir-324 precursor miRNA mir-324
Gene
family?
RF03479; mir-324

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR324 is a microRNA encoded by the MIR324 gene located on chromosome 17p13.1 in humans [PMC9399342]. In murine models, MIR324 has been implicated in the adrenergic trans-differentiation of sensory nerves in oral cancer models, particularly upon the loss of TP53 [PMC7396546]. The expression of MIR324 is regulated by TonEBP, as suggested by the identification of a TonE consensus sequence in its regulatory regions [PMC9104010]. The absence of MIR324 has been confirmed in miR-324-null mice using qRT-PCR, which also revealed a lack of expression in the hippocampus and neocortex [PMC8129095]. This deficiency leads to hippocampal hyperexcitability and an increase in epilepsy-associated events [PMC8129095]'>PMC8129095], with further research needed to determine if cognitive dysfunction also occurs as a result [PMC8129095]. The removal of MIR324 results in significant differential expression (DE) of genes associated with epilepsy and cognitive dysfunction, suggesting potential novel pharmaceutical targets for these conditions could be identified through further investigation into its downstream effects [PMC8129095]. Additionally, high expression levels of MIR324 have been associated with better prognosis for breast cancer patients, indicating its potential as a prognostic biomarker [PMC8648947].

Literature search
208 open access papers mention hsa-mir-324
(607 sentences)

Sequence

116206 reads, 304.0 reads per million, 194 experiments
cugacuaugccucccCGCAUCCCCUAGGGCAUUGGUGuaaagcuggagaCCCACUGCCCCAGGUGCUGCUGGggguuguaguc
..(((((((.(((((.(((.(.(((.(((((.(((.((..........))))).))))).))).).))).))))).)))))))

Structure
cu       c     C   U C   A     U   U  aaag 
  gacuaug cuccc GCA C CCU GGGCA UGG Gu    c
  ||||||| ||||| ||| | ||| ||||| ||| ||     
  cugaugu gggGG CGU G GGA CCCGU ACC Ca    u
--       u     U   C U   C     C   -  gagg 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr17: 7223297-7223379 [-]

Database links

Mature hsa-miR-324-5p

Accession MIMAT0000761
Description Homo sapiens hsa-miR-324-5p mature miRNA
Sequence 16 - CGCAUCCCCUAGGGCAUUGGUG - 37
Evidence experimental
cloned [4-5]
Database links
Predicted targets

Mature hsa-miR-324-3p

Accession MIMAT0000762
Description Homo sapiens hsa-miR-324-3p mature miRNA
Sequence 50 - CCCACUGCCCCAGGUGCUGCUGG - 72
Evidence experimental
cloned [3-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  4. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  5. PubMed ID: 15800047
    Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells
    "Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR"
    "Proc Natl Acad Sci U S A (2005) 102:5570-5575