WARNING: This summary was generated by AI. MIR338 is a microRNA implicated in the regulation of osteoblast lineage priming in bone marrow stromal cells, as single-cell transcriptomic analysis has shown that the ablation of MIR338 can restore this priming ability [PMC9898552]. This finding was further supported by evidence from a conditional knockdown of the MIR338 cluster specifically in the preosteoblast lineage, confirming its role in osteogenesis [PMC9898552]. Additionally, MIR338 has been studied for its diagnostic potential in hepatocellular carcinoma (HCC), with a comprehensive search for related studies conducted across multiple databases up to December 15, 2016 [PMC5783480]. This search was aimed at evaluating the diagnostic value of miR-338-5p, a specific variant of MIR338, by reviewing studies from databases such as GEO, PubMed, Embase, Cochrane Library, Web of Science, Sinomed, Chinese VIP database, Wanfang database and China National Knowledge Infrastructure (CNKI) [PMC5783480].
c U - - Gauga ucu cAACAA AUC CUGGUGCUG AGU c ||| |||||| ||| ||||||||| ||| u aga GUUGUU UAG GACUACGAC Uca c a U U C gcgga
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004701 |
| Description | Homo sapiens hsa-miR-338-5p mature miRNA |
| Sequence | 6 - AACAAUAUCCUGGUGCUGAGUG - 27 |
| Evidence |
experimental
cloned [3-4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000763 |
| Description | Homo sapiens hsa-miR-338-3p mature miRNA |
| Sequence | 42 - UCCAGCAUCAGUGAUUUUGUUG - 63 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
|