MIR339 is a microRNA that is differentially expressed between human umbilical vein endothelial cells (HUVECs) and human aortic endothelial cells (HAECs), suggesting its potential importance in endothelial cell function [PMC8216629]. It has been identified as graft-transmissible in plants, such as potatoes, which could have implications for its role in intercellular communication [PMC10067726]. In ovarian cancer (OvCa), MIR339 shows a significant increase in methylation levels associated with metastatic primary ovarian tumors and with the onset of OvCa pathogenesis [PMC8835734]. Furthermore, it is upregulated following IFN-γ stimulation, which suggests a role in immune response modulation [PMC8010072]. In pancreatic ductal adenocarcinoma (PDAC) patients, MIR339 exhibits alterations such as amplifications or deletions and differential expression between chronic pancreatitis and PDAC patients [PMC9599289]. Additionally, MIR339 is implicated in the regulation of genes associated with autism spectrum disorder (ASD) susceptibility and is located in cancer-prone chromosomal regions [PMC9906952], [PMC3634031], indicating its potential involvement in developmental disorders and oncogenesis.
----------c c cU C C C A u g
ggggcgg cgcu C CUGUC UC AGG GCUCACG gu c
||||||| |||| | ||||| || ||| ||||||| ||
ccccguc gcgG G GACAG AG UCC CGAGUgu cg c
cgcgucuguga c CC A C C G c u
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000764 |
| Description | Homo sapiens hsa-miR-339-5p mature miRNA |
| Sequence | 15 - UCCCUGUCCUCCAGGAGCUCACG - 37 |
| Evidence |
experimental
cloned [2,4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004702 |
| Description | Homo sapiens hsa-miR-339-3p mature miRNA |
| Sequence | 50 - UGAGCGCCUCGACGACAGAGCCG - 72 |
| Evidence |
experimental
cloned [4] |
| Database links |
|
| Predicted targets |
|
|