MIR339 is a microRNA that has been studied in various contexts. It has been found that ZMYND8-binding peaks at enhancer regions related to MIR339, Lrrc28, and Lipa were diminished [PMC8586003]. MIR339 is one of the differentially expressed pri-miRNAs in HUVECs and HAECs [PMC8216629]. It has also been identified as a graft-transmissible miRNA in potatoes [PMC10067726]. In the context of ovarian tumors, an increase in the methylation level of MIR339 was associated with metastatic primary ovarian tumors and the onset of OvCa pathogenesis [PMC8835734]. In another study, MIR339 was found to be upregulated after IFN-γ stimulation [PMC8010072]. Additionally, MIR339 was validated as a miRNA in different contexts such as multiple sclerosis and pancreatic ductal adenocarcinoma (PDAC) [PMC6006352] [PMC9599289]. It has also been reported that MIR339 is involved in regulating sucrose degradation and sucrose synthase production at a transcription level [PMC3997385]. Overall, these studies highlight the diverse roles of MIR339 in various biological processes.
----------c c cU C C C A u g ggggcgg cgcu C CUGUC UC AGG GCUCACG gu c ||||||| |||| | ||||| || ||| ||||||| || ccccguc gcgG G GACAG AG UCC CGAGUgu cg c cgcgucuguga c CC A C C G c u
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000764 |
Description | Homo sapiens hsa-miR-339-5p mature miRNA |
Sequence | 15 - UCCCUGUCCUCCAGGAGCUCACG - 37 |
Evidence |
experimental
cloned [2,4] |
Database links | |
Predicted targets |
Accession | MIMAT0004702 |
Description | Homo sapiens hsa-miR-339-3p mature miRNA |
Sequence | 50 - UGAGCGCCUCGACGACAGAGCCG - 72 |
Evidence |
experimental
cloned [4] |
Database links | |
Predicted targets |
|