miRBase entry: hsa-mir-339

Stem-loop hsa-mir-339


Accession
MI0000815
Symbol
HGNC: MIR339
Description
Homo sapiens hsa-mir-339 precursor miRNA mir-339
Gene
family?
RF00763; mir-339

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR339 is a microRNA that has been studied in various contexts. It has been found that ZMYND8-binding peaks at enhancer regions related to MIR339, Lrrc28, and Lipa were diminished [PMC8586003]. MIR339 is one of the differentially expressed pri-miRNAs in HUVECs and HAECs [PMC8216629]. It has also been identified as a graft-transmissible miRNA in potatoes [PMC10067726]. In the context of ovarian tumors, an increase in the methylation level of MIR339 was associated with metastatic primary ovarian tumors and the onset of OvCa pathogenesis [PMC8835734]. In another study, MIR339 was found to be upregulated after IFN-γ stimulation [PMC8010072]. Additionally, MIR339 was validated as a miRNA in different contexts such as multiple sclerosis and pancreatic ductal adenocarcinoma (PDAC) [PMC6006352] [PMC9599289]. It has also been reported that MIR339 is involved in regulating sucrose degradation and sucrose synthase production at a transcription level [PMC3997385]. Overall, these studies highlight the diverse roles of MIR339 in various biological processes.

Literature search
58 open access papers mention hsa-mir-339
(200 sentences)

Sequence

53279 reads, 572 reads per million, 132 experiments
cggggcggccgcucUCCCUGUCCUCCAGGAGCUCACGugugccugccugUGAGCGCCUCGACGACAGAGCCGgcgccugccccagugucugcgc
.(((((((.((((..(.(((((.((.(((.(((((((.((....)).))))))).))).)).))))).)..)))).)))))))...........

Structure
----------c       c    cU C     C  C   A       u  g 
           ggggcgg cgcu  C CUGUC UC AGG GCUCACG gu c
           ||||||| ||||  | ||||| || ||| ||||||| ||  
           ccccguc gcgG  G GACAG AG UCC CGAGUgu cg c
cgcgucuguga       c    CC A     C  C   G       c  u 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,3]. Expression of mature miRNA was later verified in human [2,4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chr7: 1022933-1023026 [-]

Disease association
hsa-mir-339 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-339-5p

Accession MIMAT0000764
Description Homo sapiens hsa-miR-339-5p mature miRNA
Sequence 15 - UCCCUGUCCUCCAGGAGCUCACG - 37
Evidence experimental
cloned [2,4]
Database links
Predicted targets

Mature hsa-miR-339-3p

Accession MIMAT0004702
Description Homo sapiens hsa-miR-339-3p mature miRNA
Sequence 50 - UGAGCGCCUCGACGACAGAGCCG - 72
Evidence experimental
cloned [4]
Database links
Predicted targets

References

  1. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  4. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365