Accession | MIMAT0000764 |
Description | hsa-miR-339-5p mature miRNA |
Hairpins | |
Sequence | UCCCUGUCCUCCAGGAGCUCACG |
Evidence |
experimental
cloned [2,4] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:1902430 negative regulation of amyloid-beta formation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24352696 | occurs_in UBERON:0006238 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24352696 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24352696 | |
involved_in | GO:0010951 negative regulation of endopeptidase activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24352696 | has_input UniProtKB:P56817 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24352696 | |
involved_in | GO:0044344 cellular response to fibroblast growth factor stimulus |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in CL:0002591 |
involved_in | GO:1904706 negative regulation of vascular associated smooth muscle cell proliferation |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | results_in_division_of CL:0002591 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|