MIR335 is a microRNA that is deregulated in adipose-derived stem cells (ASCs) and is associated with impaired lamin A association with the T locus in mutant induced pluripotent stem (iPS) cells [PMC6053905]. In addition, MIR335 is found in extracellular vesicles (EVs) and targets genes involved in "Ras protein signal transduction" and "Actin/microtubule cytoskeleton organization" [PMC7287171]. MIR335 is a microRNA that plays a role in the regulation of gene expression. In ASCs, its deregulation correlates with impaired lamin A association with the T locus, suggesting its involvement in cellular processes related to adipose tissue [PMC6053905]. Furthermore, MIR335 is found in EVs and targets genes involved in important cellular pathways such as Ras protein signal transduction and Actin/microtubule cytoskeleton organization [PMC7287171]. This suggests that MIR335 may have a role in regulating these pathways through its interaction with target genes. Overall, these findings highlight the importance of MIR335 in cellular processes related to adipose tissue regulation as well as its potential involvement in important signaling pathways. Further research on the specific mechanisms by which MIR335 regulates gene expression and its functional implications could provide valuable insights into the understanding of adipose tissue biology and related diseases.
--------uguuu c A C U gu ugag gggggUCA GAGCAAUAA GAAAAAUG uu c |||| |||||||| ||||||||| |||||||| || acuc ccuCCAGU CUCGUUAUU CUUUUUgc aa a acuuauaucguuu u C A c au
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000765 |
Description | Homo sapiens hsa-miR-335-5p mature miRNA |
Sequence | 16 - UCAAGAGCAAUAACGAAAAAUGU - 38 |
Evidence |
experimental
cloned [3-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004703 |
Description | Homo sapiens hsa-miR-335-3p mature miRNA |
Sequence | 52 - UUUUUCAUUAUUGCUCCUGACC - 73 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|