miRBase entry: hsa-mir-335

Stem-loop hsa-mir-335


Accession
MI0000816
Symbol
HGNC: MIR335
Description
Homo sapiens hsa-mir-335 precursor miRNA mir-335
Gene
family?
RF00766; mir-335

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR335 is a microRNA implicated in various cellular processes, and its deregulation has been observed in adipose-derived stem cells (ASCs) [PMC6053905]. This deregulation is associated with a disruption in the timely inactivation of the T gene, which is further linked to compromised lamin A interaction with the T locus, as evidenced by studies conducted on mutant induced pluripotent stem cells (iPS cells) [PMC6053905]. Additionally, MIR335 is among a group of microRNAs, including MIR24-2, MIR142, MIR490, and MIR296, that are present in extracellular vesicles (EVs) [PMC7287171]. These microRNAs are known to target genes that are predominantly involved in critical signaling and structural pathways within the cell such as "Ras protein signal transduction" and "Actin/microtubule cytoskeleton organization" [PMC7287171]. The presence of MIR335 within EVs suggests its potential role in intercellular communication and regulation of these pathways.

Literature search
169 open access papers mention hsa-mir-335
(872 sentences)

Sequence

142955 reads, 4193 reads per million, 137 experiments
uguuuugagcgggggUCAAGAGCAAUAACGAAAAAUGUuugucauaaaccgUUUUUCAUUAUUGCUCCUGACCuccucucauuugcuauauuca
.....((((.((((((((.(((((((((.((((((((.((......)).)))))))).))))))))).)))))))).)))).............

Structure
--------uguuu    c        A         C        U  gu 
             ugag gggggUCA GAGCAAUAA GAAAAAUG uu  c
             |||| |||||||| ||||||||| |||||||| ||   
             acuc ccuCCAGU CUCGUUAUU CUUUUUgc aa  a
acuuauaucguuu    u        C         A        c  au 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2], later verified in human [3].

Genome context
chr7: 130496111-130496204 [+]

Disease association
hsa-mir-335 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-335-5p

Accession MIMAT0000765
Description Homo sapiens hsa-miR-335-5p mature miRNA
Sequence 16 - UCAAGAGCAAUAACGAAAAAUGU - 38
Evidence experimental
cloned [3-4]
Database links
Predicted targets

Mature hsa-miR-335-3p

Accession MIMAT0004703
Description Homo sapiens hsa-miR-335-3p mature miRNA
Sequence 52 - UUUUUCAUUAUUGCUCCUGACC - 73
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  4. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365