Stem-loop mmu-mir-133a-2

Accession

MI0000820

Symbol

MGI: Mir133a-2

Description

Mus musculus mmu-mir-133a-2 precursor miRNA

Literature search

265 open access papers mention mmu-mir-133a-2
(1793 sentences)

Sequence

696284 reads, 3405.0 reads per million, 127 experiments

agaagccaaaugcuuugcugaAGCUGGUAAAAUGGAACCAAAUCagcuguuggauggaUUUGGUCCCCUUCAACCAGCUGUagcugcgcauugaucacgccgca
........(((((...((((.(((((((..((.((.((((((((..(....)....)))))))).)).))..))))))).))))...)))))............

Structure

----agaagcca     uuu    a       AA  U  A        --ag u 
            aaugc   gcug AGCUGGU  AA GG ACCAAAUC    c g
            |||||   |||| |||||||  || || ||||||||    |  
            uuacg   cgaU UCGACCA  UU CC UGGUUUag    g u
acgccgcacuag     cgu    G       AC  C  C        guag u 

Annotation confidence High

Comments

This mature miRNA sequence was named miR-133 in reference [1], and renamed miR-133a on subsequent identification of a homologue differing at the terminal 3' position (MIR:MI0000821). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

2: 180040172-180040275 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from mmu-mir-133a-2

Mature mmu-miR-133a-5p

• Accession: MIMAT0003473
• Description: Mus musculus mmu-miR-133a-5p mature miRNA
• Sequence: 22 - AGCUGGUAAAAUGGAACCAAAUC - 44
• Evidence: experimental ; MPSS [2], Illumina [4-5]

Mature mmu-miR-133a-3p

• Accession: MIMAT0000145
• Description: Mus musculus mmu-miR-133a-3p mature miRNA
• Sequence: 59 - UUUGGUCCCCUUCAACCAGCUGU - 81
• Evidence: experimental ; cloned [1,3], Illumina [4-5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739


3. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


4. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


5. PubMed ID: 16582102
   The expression profile of microRNAs in mouse embryos
   "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
   "Nucleic Acids Res (2006) 34:1765-1771