miRBase entry: mmu-mir-133a-2

Stem-loop mmu-mir-133a-2


Accession
MI0000820
Symbol
MGI: Mir133a-2
Description
Mus musculus mmu-mir-133a-2 precursor miRNA

Literature search
236 open access papers mention mmu-mir-133a-2
(1746 sentences)

Sequence

147314 reads, 1683 reads per million, 75 experiments
agaagccaaaugcuuugcugaaGCUGGUAAAAUGGAACCAAAUcagcuguuggauggaUUUGGUCCCCUUCAACCAGCUGuagcugcgcauugaucacgccgca
........(((((...((((.(((((((..((.((.((((((((..(....)....)))))))).)).))..))))))).))))...)))))............

Structure
----agaagcca     uuu    a       AA  U  A        --ag u 
            aaugc   gcug aGCUGGU  AA GG ACCAAAUc    c g
            |||||   |||| |||||||  || || ||||||||    |  
            uuacg   cgau UCGACCA  UU CC UGGUUUag    g u
acgccgcacuag     cgu    G       AC  C  C        guag u 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
This mature miRNA sequence was named miR-133 in reference [1], and renamed miR-133a on subsequent identification of a homologue differing at the terminal 3' position (MIR:MI0000821). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr2: 180398379-180398482 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-133a-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-133a-5p

Accession MIMAT0003473
Description Mus musculus mmu-miR-133a-5p mature miRNA
Sequence 23 - GCUGGUAAAAUGGAACCAAAU - 43
Evidence experimental
MPSS [2], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-133a-3p

Accession MIMAT0000145
Description Mus musculus mmu-miR-133a-3p mature miRNA
Sequence 59 - UUUGGUCCCCUUCAACCAGCUG - 80
Evidence experimental
cloned [1,3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  5. PubMed ID: 16582102
    The expression profile of microRNAs in mouse embryos
    "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
    "Nucleic Acids Res (2006) 34:1765-1771