miRBase entry: hsa-mir-133b

Stem-loop hsa-mir-133b


Accession
MI0000822
Symbol
HGNC: MIR133B
Description
Homo sapiens hsa-mir-133b precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR133B is a microRNA that has been studied in various contexts. In one study, it was found that the long non-coding RNA (lncRNA) LOC400043 interacts with MIR133B, leading to the downregulation of its expression [PMC7068214]. Another study demonstrated that the insertion of miRNA target sites for MIR133B and miR206 into the NP genome segment of influenza A virus effectively attenuated infection in murine myocyte-like cells and in the heart [PMC9094651]. In addition to these findings, other researchers have also investigated miRNAs in Parkinson's disease (PD) tissues, including MIR133B [PMC3540391]. Furthermore, the effect of intranasal delivery of MIR133B on functional recovery was assessed using two behavior tasks: GSM for forelimb grip strength evaluation and hanging task for forelimb grasp assessment post-spinal cord injury (SCI) [PMC10047048]. These studies highlight the importance of MIR133B in various biological processes and its potential therapeutic applications.

Literature search
328 open access papers mention hsa-mir-133b
(1862 sentences)

Sequence

12384 reads, 266 reads per million, 108 experiments
ccucagaagaaagaugcccccugcucuggcuggucaaacggaaccaaguccgucuuccugagaggUUUGGUCCCCUUCAACCAGCUAcagcagggcuggcaaugcccaguccuuggaga
..............(((((((((((.((((((((..((.((.((((((.((.((((...)))))))))))).)).))..)))))))).)))))))..))))....(((.....)))...

Structure
----ccucagaagaaaga    --       c        ca  c  a      u  g    c 
                  ugcc  cccugcu uggcuggu  aa gg accaag cc ucuu  
                  ||||  ||||||| ||||||||  || || |||||| || |||| c
                  acgg  gggacga AUCGACCA  UU CC UGGUUU gg agag  
agagguuccugacccgua    uc       c        AC  C  C      -  -    u 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
miR-133b was predicted based on comparative analysis of human, mouse and Fugu [1], and later verified in human [2].

Genome context
chr6: 52148923-52149041 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-133b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-133b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-133b

Accession MIMAT0000770
Description Homo sapiens hsa-miR-133b mature miRNA
Sequence 66 - UUUGGUCCCCUUCAACCAGCUA - 87
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540