miRBase entry: rno-let-7a-2

Stem-loop rno-let-7a-2


Accession
MI0000828
Description
Rattus norvegicus rno-let-7a-2 precursor miRNA

Literature search
114 open access papers mention rno-let-7a-2
(867 sentences)

Sequence

3803762 reads, 3492 reads per million, 513 experiments
cggcaugcucccaggcUGAGGUAGUAGGUUGUAUAGUUuagaguuacaacaagggagauaaCUGUACAGCCUCCUAGCUUUCCuugggacuugcac
..(((.(.(((((((..(((.(((.(((((((((((((.....................))))))))))))).))).)))..)))))))).)))..

Structure
cg   u c       cU   G   U             uagaguuac 
  gca g ucccagg  GAG UAG AGGUUGUAUAGUU         a
  ||| | |||||||  ||| ||| |||||||||||||         a
  cgu c aggguuC  UUC AUC UCCGACAUGUCaa         c
ca   u -       CU   G   C             uagagggaa 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr8: 45753264-45753359 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from rno-let-7a-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-let-7a-5p

Accession MIMAT0000774
Description Rattus norvegicus rno-let-7a-5p mature miRNA
Sequence 17 - UGAGGUAGUAGGUUGUAUAGUU - 38
Evidence experimental
cloned [1-4], SOLiD [5]

Mature rno-let-7a-2-3p

Accession MIMAT0017086
Description Rattus norvegicus rno-let-7a-2-3p mature miRNA
Sequence 62 - CUGUACAGCCUCCUAGCUUUCC - 83
Evidence experimental
SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  5. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68