miRBase entry: rno-let-7c-1

Stem-loop rno-let-7c-1


Accession
MI0000830
Description
Rattus norvegicus rno-let-7c-1 precursor miRNA

Literature search
101 open access papers mention rno-let-7c-1
(519 sentences)

Sequence

4806961 reads, 4658 reads per million, 512 experiments
ugugugcauccggguUGAGGUAGUAGGUUGUAUGGUUuagaguuacacccugggaguuaaCUGUACAACCUUCUAGCUUUCCuuggagcacacu
.((((((.((((((..(((.(((.(((((((((((((..((.(..((...))..).))))))))))))))).))).)))..)))))))))))).

Structure
u      a      uU   G   U             ua  g ua  c 
 gugugc uccggg  GAG UAG AGGUUGUAUGGUU  ga u  ca  
 |||||| ||||||  ||| ||| |||||||||||||  || |  || c
 cacacg agguuC  UUC AUC UCCAACAUGUCaa  uu a  gu  
u      -      CU   G   U             --  g gg  c 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr11: 16052873-16052966 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from rno-let-7c-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-let-7c-5p

Accession MIMAT0000776
Description Rattus norvegicus rno-let-7c-5p mature miRNA
Sequence 16 - UGAGGUAGUAGGUUGUAUGGUU - 37
Evidence experimental
cloned [1-5], SOLiD [6]

Mature rno-let-7c-1-3p

Accession MIMAT0017087
Description Rattus norvegicus rno-let-7c-1-3p mature miRNA
Sequence 61 - CUGUACAACCUUCUAGCUUUCC - 82
Evidence experimental
SOLiD [6]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  5. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68

  6. PubMed ID: 17805466
    Cloning and identification of novel microRNAs from rat hippocampus
    "He X, Zhang Q, Liu Y, Pan X"
    "Acta Biochim Biophys Sin (Shanghai) (2007) 39:708-714