Stem-loop rno-let-7i

Accession

MI0000835

Description

Rattus norvegicus rno-let-7i precursor miRNA

Gene family

MIPF0000002; let-7

Literature search

107 open access papers mention rno-let-7i
(596 sentences)

Sequence

3081571 reads, 3479 reads per million, 512 experiments

cuggcUGAGGUAGUAGUUUGUGCUGUUggucggguugugacauugcccgcuguggagauaaCUGCGCAAGCUACUGCCUUGCUag
(((((.(((((((((((((((((.(((((.(((((.........)))))))........))).))))))))))))))))))))))

Structure

     U                 U   --------  u     ugu 
cuggc GAGGUAGUAGUUUGUGC GUU        gg cgggu   g
||||| ||||||||||||||||| |||        || |||||   a
gaUCG UUCCGUCAUCGAACGCG Caa        uc gcccg   c
     -                 U   uagaggug  -     uua 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

chr7: 66802731-66802815 [+]

Mature rno-let-7i-5p

• Accession: MIMAT0000779
• Description: Rattus norvegicus rno-let-7i-5p mature miRNA
• Sequence: 6 - UGAGGUAGUAGUUUGUGCUGUU - 27
• Evidence: experimental ; cloned [1-5], SOLiD [6]

Mature rno-let-7i-3p

• Accession: MIMAT0004707
• Description: Rattus norvegicus rno-let-7i-3p mature miRNA
• Sequence: 62 - CUGCGCAAGCUACUGCCUUGCU - 83
• Evidence: experimental ; cloned [4], SOLiD [6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


3. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365


4. PubMed ID: 20403161
   Small RNA expression and strain specificity in the rat
   Linsen SE, de Wit E, de Bruijn E, Cuppen E
   BMC Genomics (2010) 11:249


5. PubMed ID: 15345052
   Microarray analysis of microRNA expression in the developing mammalian brain
   Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
   Genome Biol (2004) 5:R68


6. PubMed ID: 17805466
   Cloning and identification of novel microRNAs from rat hippocampus
   "He X, Zhang Q, Liu Y, Pan X"
   "Acta Biochim Biophys Sin (Shanghai) (2007) 39:708-714