miRBase entry: rno-mir-21

Stem-loop rno-mir-21


Accession
MI0000850
Description
Rattus norvegicus rno-mir-21 precursor miRNA
Gene family
MIPF0000060; mir-21

Literature search
236 open access papers mention rno-mir-21
(2499 sentences)

Sequence

7401062 reads, 8269 reads per million, 510 experiments
uguaccaccuugucgggUAGCUUAUCAGACUGAUGUUGAcuguugaaucucauggCAACAGCAGUCGAUGGGCUGUCugacauuuugguauc
.((((((...((((((((((((((((.(((((.(((((.((((.((...))))))))))).)))))))))))))))))))))...)))))).

Structure
u      ccu                A     A     A    u  a 
 guacca   ugucgggUAGCUUAUC GACUG UGUUG cugu ga  
 ||||||   |||||||||||||||| ||||| ||||| |||| || u
 uauggu   acaguCUGUCGGGUAG CUGAC ACAAC ggua cu  
c      uuu                -     G     -    -  c 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr10: 73902210-73902301 [-]

Database links

Mature rno-miR-21-5p

Accession MIMAT0000790
Description Rattus norvegicus rno-miR-21-5p mature miRNA
Sequence 18 - UAGCUUAUCAGACUGAUGUUGA - 39
Evidence experimental
cloned [1-4], SOLiD [5]

Mature rno-miR-21-3p

Accession MIMAT0004711
Description Rattus norvegicus rno-miR-21-3p mature miRNA
Sequence 56 - CAACAGCAGUCGAUGGGCUGUC - 77
Evidence experimental
cloned [3], SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  5. PubMed ID: 17805466
    Cloning and identification of novel microRNAs from rat hippocampus
    "He X, Zhang Q, Liu Y, Pan X"
    "Acta Biochim Biophys Sin (Shanghai) (2007) 39:708-714