miRBase entry: rno-mir-22

Stem-loop rno-mir-22


Accession
MI0000851
Description
Rattus norvegicus rno-mir-22 precursor miRNA
Gene family
MIPF0000053; mir-22

Literature search
41 open access papers mention rno-mir-22
(290 sentences)

Sequence

102501020 reads, 83171 reads per million, 510 experiments
accuggcugagccgcaguAGUUCUUCAGUGGCAAGCUUUAuguccugacccagcuaAAGCUGCCAGUUGAAGAACUGUugcccucugccacuggc
.((((((.(((..((((((((((((((((((((.((((((.((.........))))))))))))).))))))))))))))).))).))))..)).

Structure
a  --    u   cc               -     A      u  ccu 
 cc  uggc gag  gcaguAGUUCUUCAG UGGCA GCUUUA gu   g
 ||  |||| |||  ||||||||||||||| ||||| |||||| ||   a
 gg  accg cuc  cguUGUCAAGAAGUU ACCGU CGAAau cg   c
c  uc    u   -c               G     -      -  acc 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr10: 62299592-62299686 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from rno-mir-22
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-22-5p

Accession MIMAT0003152
Description Rattus norvegicus rno-miR-22-5p mature miRNA
Sequence 19 - AGUUCUUCAGUGGCAAGCUUUA - 40
Evidence experimental
cloned [2-3], SOLiD [5]

Mature rno-miR-22-3p

Accession MIMAT0000791
Description Rattus norvegicus rno-miR-22-3p mature miRNA
Sequence 57 - AAGCUGCCAGUUGAAGAACUGU - 78
Evidence experimental
cloned [1-4], SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  5. PubMed ID: 17805466
    Cloning and identification of novel microRNAs from rat hippocampus
    "He X, Zhang Q, Liu Y, Pan X"
    "Acta Biochim Biophys Sin (Shanghai) (2007) 39:708-714