miRBase entry: rno-mir-29a

Stem-loop rno-mir-29a


Accession
MI0000863
Description
Rattus norvegicus rno-mir-29a precursor miRNA

Literature search
414 open access papers mention rno-mir-29a
(1751 sentences)

Sequence

2399794 reads, 2635.0 reads per million, 510 experiments
accccuuagaggaugACUGAUUUCUUUUGGUGUUCAGagucaauagaauuuucUAGCACCAUCUGAAAUCGGUUAuaaugauugggga
.((((....(..((((((((((((...(((((((.((((...........)))))))))))...))))))))))))..)....)))).

Structure
a    uuag gg            UUU       C    ucaa 
 cccc    a  augACUGAUUUC   UGGUGUU AGag    u
 ||||    |  ||||||||||||   ||||||| ||||    a
 gggg    u  uAUUGGCUAAAG   ACCACGA Ucuu    g
a    uuag aa            UCU       -    uuaa 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr4: 58343931-58344018 [-]
Clustered miRNAs
3 other miRNAs are < 10 kb from rno-mir-29a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-29a-5p

Accession MIMAT0004718
Description Rattus norvegicus rno-miR-29a-5p mature miRNA
Sequence 16 - ACUGAUUUCUUUUGGUGUUCAG - 37
Evidence experimental
cloned [4], SOLiD [5]

Mature rno-miR-29a-3p

Accession MIMAT0000802
Description Rattus norvegicus rno-miR-29a-3p mature miRNA
Sequence 54 - UAGCACCAUCUGAAAUCGGUUA - 75
Evidence experimental
cloned [1-4], SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  5. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68