miRBase entry: rno-mir-30c-1

Stem-loop rno-mir-30c-1


Accession
MI0000866
Description
Rattus norvegicus rno-mir-30c-1 precursor miRNA

Literature search
60 open access papers mention rno-mir-30c-1
(514 sentences)

Sequence

5575377 reads, 4152 reads per million, 510 experiments
accauguuguagugugUGUAAACAUCCUACACUCUCAGCugugagcucaagguggCUGGGAGAGGGUUGUUUACUCCuucugccaugga
.(((((..((((...(.(((((((.(((...(((((((((....(((...)))))))))))).))).))))))).)...))))))))).

Structure
a     uu    ugu U       U   ACA         guga   c 
 ccaug  guag   g GUAAACA CCU   CUCUCAGCu    gcu  
 |||||  ||||   | ||||||| |||   |||||||||    ||| a
 gguac  cguc   C CAUUUGU GGG   GAGGGUCgg    ugg  
a     --    uuC U       U   --A         ----   a 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr5: 139699877-139699965 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from rno-mir-30c-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-30c-5p

Accession MIMAT0000804
Description Rattus norvegicus rno-miR-30c-5p mature miRNA
Sequence 17 - UGUAAACAUCCUACACUCUCAGC - 39
Evidence experimental
cloned [1-5], SOLiD [6]

Mature rno-miR-30c-1-3p

Accession MIMAT0004719
Description Rattus norvegicus rno-miR-30c-1-3p mature miRNA
Sequence 56 - CUGGGAGAGGGUUGUUUACUCC - 77
Evidence experimental
cloned [4], SOLiD [6]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  5. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68

  6. PubMed ID: 17805466
    Cloning and identification of novel microRNAs from rat hippocampus
    "He X, Zhang Q, Liu Y, Pan X"
    "Acta Biochim Biophys Sin (Shanghai) (2007) 39:708-714