miRBase entry: rno-mir-30c-2

Stem-loop rno-mir-30c-2


Accession
MI0000871
Description
Rattus norvegicus rno-mir-30c-2 precursor miRNA

Literature search
62 open access papers mention rno-mir-30c-2
(519 sentences)

Sequence

5562944 reads, 4156 reads per million, 511 experiments
gagugacagauacUGUAAACAUCCUACACUCUCAGCugugaaaaguaagaaagCUGGGAGAAGGCUGUUUACUCUcucugccuu
(((.(.((((....(((((((.(((...(((((((((..............))))))))).))).)))))))....))))))))

Structure
   u a    uacU       U   ACA         gugaaa 
gag g caga    GUAAACA CCU   CUCUCAGCu      a
||| | ||||    ||||||| |||   |||||||||       
uuc c gucu    CAUUUGU GGA   GAGGGUCga      g
   - -    cUCU       C   --A         aagaau 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr9: 29562376-29562459 [+]

Database links

Mature rno-miR-30c-5p

Accession MIMAT0000804
Description Rattus norvegicus rno-miR-30c-5p mature miRNA
Sequence 14 - UGUAAACAUCCUACACUCUCAGC - 36
Evidence experimental
cloned [1-5], SOLiD [6]

Mature rno-miR-30c-2-3p

Accession MIMAT0005442
Description Rattus norvegicus rno-miR-30c-2-3p mature miRNA
Sequence 54 - CUGGGAGAAGGCUGUUUACUCU - 75
Evidence experimental
cloned [4], SOLiD [6]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  5. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68

  6. PubMed ID: 17805466
    Cloning and identification of novel microRNAs from rat hippocampus
    "He X, Zhang Q, Liu Y, Pan X"
    "Acta Biochim Biophys Sin (Shanghai) (2007) 39:708-714