Stem-loop rno-mir-99a

Accession

MI0000883

Description

Rattus norvegicus rno-mir-99a precursor miRNA

Gene family

MIPF0000033; mir-10

Literature search

22 open access papers mention rno-mir-99a
(58 sentences)

Sequence

810425 reads, 872 reads per million, 491 experiments

cccauuggcauaAACCCGUAGAUCCGAUCUUGUGgugaaguggaccgcaCAAGCUCGUUUCUAUGGGUCUGuggcagugug
..(((((.((((.(((((((((..(((.((((((.((........)))))))).)))..))))))))).)))).)))))..

Structure

cc     g    A         UC   U      g  aag 
  cauug caua ACCCGUAGA  CGA CUUGUG ug   u
  ||||| |||| |||||||||  ||| |||||| ||    
  gugac guGU UGGGUAUCU  GCU GAACac gc   g
gu     g    C         UU   C      -  cag 

Annotation confidence High

Genome context

chr11: 16052153-16052233 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from rno-mir-99a

Mature rno-miR-99a-5p

• Accession: MIMAT0000820
• Description: Rattus norvegicus rno-miR-99a-5p mature miRNA
• Sequence: 13 - AACCCGUAGAUCCGAUCUUGUG - 34
• Evidence: experimental ; cloned [1-5], SOLiD [6]

Mature rno-miR-99a-3p

• Accession: MIMAT0004724
• Description: Rattus norvegicus rno-miR-99a-3p mature miRNA
• Sequence: 50 - CAAGCUCGUUUCUAUGGGUCUG - 71
• Evidence: experimental ; cloned [4], SOLiD [6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


3. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365


4. PubMed ID: 20403161
   Small RNA expression and strain specificity in the rat
   Linsen SE, de Wit E, de Bruijn E, Cuppen E
   BMC Genomics (2010) 11:249


5. PubMed ID: 15345052
   Microarray analysis of microRNA expression in the developing mammalian brain
   Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
   Genome Biol (2004) 5:R68


6. PubMed ID: 17805466
   Cloning and identification of novel microRNAs from rat hippocampus
   "He X, Zhang Q, Liu Y, Pan X"
   "Acta Biochim Biophys Sin (Shanghai) (2007) 39:708-714