Stem-loop rno-mir-99b

Accession

MI0000884

Description

Rattus norvegicus rno-mir-99b precursor miRNA

Literature search

13 open access papers mention rno-mir-99b
(51 sentences)

Sequence

4687616 reads, 3683 reads per million, 504 experiments

ggcaccCACCCGUAGAACCGACCUUGCGgggccuucgccgcacaCAAGCUCGUGUCUGUGGGUCCGuguc
(((((..(((((((((..(((.((((.(.(((....))).)...)))).)))..)))))))))..)))))

Structure

     cC         AC   C    --C g   c 
ggcac  ACCCGUAGA  CGA CUUG   G ggc u
|||||  |||||||||  ||| ||||   | |||  
cuguG  UGGGUGUCU  GCU GAAC   c ccg u
     CC         GU   C    aca g   c 

Annotation confidence High

Genome context

chr1: 59704216-59704285 [+]

Clustered miRNAs

3 other miRNAs are < 10 kb from rno-mir-99b

Mature rno-miR-99b-5p

• Accession: MIMAT0000821
• Description: Rattus norvegicus rno-miR-99b-5p mature miRNA
• Sequence: 7 - CACCCGUAGAACCGACCUUGCG - 28
• Evidence: experimental ; cloned [1-4], Northern [1,3], SOLiD [5]

Mature rno-miR-99b-3p

• Accession: MIMAT0004725
• Description: Rattus norvegicus rno-miR-99b-3p mature miRNA
• Sequence: 45 - CAAGCUCGUGUCUGUGGGUCCG - 66
• Evidence: experimental ; cloned [4], SOLiD [5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


3. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365


4. PubMed ID: 20403161
   Small RNA expression and strain specificity in the rat
   Linsen SE, de Wit E, de Bruijn E, Cuppen E
   BMC Genomics (2010) 11:249


5. PubMed ID: 15345052
   Microarray analysis of microRNA expression in the developing mammalian brain
   Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
   Genome Biol (2004) 5:R68