Stem-loop rno-mir-103-2

Accession

MI0000887

Description

Rattus norvegicus rno-mir-103-2 precursor miRNA

Literature search

31 open access papers mention rno-mir-103-2
(125 sentences)

Sequence

1249108 reads, 1247 reads per million, 506 experiments

gucuucgugcuuucAGCUUCUUUACAGUGCUgccuuguagcauucaggucaAGCAGCAUUGUACAGGGCUAUGAaagaaccaagaa
.((((.((.(((((((((.((.(((((((((((.(((.(.(.....).))))))))))))))).)))))..)))))).)).)))).

Structure

g    c  g      --   U  U           c   u g a 
 ucuu gu cuuucA  GCU CU UACAGUGCUgc uug a c u
 |||| || ||||||  ||| || ||||||||||| ||| | | u
 agaa ca gaaAGU  CGG GA AUGUUACGACG Aac u g c
a    c  a      AU   -  C           -   - g a 

Annotation confidence High

Genome context

chr3: 123833671-123833756 [+]

Mature rno-miR-103-2-5p

• Accession: MIMAT0017113
• Description: Rattus norvegicus rno-miR-103-2-5p mature miRNA
• Sequence: 15 - AGCUUCUUUACAGUGCU - 31
• Evidence: experimental ; SOLiD [4]

Mature rno-miR-103-3p

• Accession: MIMAT0000824
• Description: Rattus norvegicus rno-miR-103-3p mature miRNA
• Sequence: 52 - AGCAGCAUUGUACAGGGCUAUGA - 74
• Evidence: experimental ; cloned [1-4], Northern [1,3], SOLiD [5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


3. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365


4. PubMed ID: 20403161
   Small RNA expression and strain specificity in the rat
   Linsen SE, de Wit E, de Bruijn E, Cuppen E
   BMC Genomics (2010) 11:249