Stem-loop rno-mir-124-3

Accession

MI0000892

Description

Rattus norvegicus rno-mir-124-3 precursor miRNA

Literature search

86 open access papers mention rno-mir-124-3
(387 sentences)

Sequence

1003543 reads, 6264 reads per million, 365 experiments

ugagggccccucugCGUGUUCACAGCGGACCUUGAUuuaaugucuauacaauUAAGGCACGCGGUGAAUGCCaagagaggcgccucc
.(((((((.((((..((((((((.(((..((((((((............))))))))..))).))))))))..)))).))).)))).

Structure

u    -   c    gC        A   GA        uaaug 
 gagg gcc cucu  GUGUUCAC GCG  CCUUGAUu     u
 |||| ||| ||||  |||||||| |||  ||||||||      
 cucc cgg gaga  CGUAAGUG CGC  GGAAUuaa     c
c    g   a    aC        G   AC        cauau 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

chr3: 176406205-176406291 [+]

Mature rno-miR-124-5p

• Accession: MIMAT0004728
• Description: Rattus norvegicus rno-miR-124-5p mature miRNA
• Sequence: 15 - CGUGUUCACAGCGGACCUUGAU - 36
• Evidence: experimental ; cloned [3], SOLiD [4]

Mature rno-miR-124-3p

• Accession: MIMAT0000828
• Description: Rattus norvegicus rno-miR-124-3p mature miRNA
• Sequence: 53 - UAAGGCACGCGGUGAAUGCC - 72
• Evidence: experimental ; cloned [1-3], Northern [1], SOLiD [4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365


3. PubMed ID: 20403161
   Small RNA expression and strain specificity in the rat
   Linsen SE, de Wit E, de Bruijn E, Cuppen E
   BMC Genomics (2010) 11:249


4. PubMed ID: 15345052
   Microarray analysis of microRNA expression in the developing mammalian brain
   Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
   Genome Biol (2004) 5:R68