Stem-loop rno-mir-124-1

Accession

MI0000893

Description

Rattus norvegicus rno-mir-124-1 precursor miRNA

Literature search

88 open access papers mention rno-mir-124-1
(396 sentences)

Sequence

1003626 reads, 6266 reads per million, 363 experiments

aggccucucucucCGUGUUCACAGCGGACCUUGAUuuaaauguccauacaauUAAGGCACGCGGUGAAUGCCaagaauggggcug
.((((((..(((..((((((((.(((..((((((((.............))))))))..))).))))))))..)))..)))))).

Structure

a      uc   cC        A   GA        uaaau 
 ggccuc  ucu  GUGUUCAC GCG  CCUUGAUu     g
 ||||||  |||  |||||||| |||  ||||||||     u
 ucgggg  aga  CGUAAGUG CGC  GGAAUuaa     c
g      ua   aC        G   AC        cauac 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

chr15: 47964298-47964382 [+]

Mature rno-miR-124-5p

• Accession: MIMAT0004728
• Description: Rattus norvegicus rno-miR-124-5p mature miRNA
• Sequence: 14 - CGUGUUCACAGCGGACCUUGAU - 35
• Evidence: experimental ; cloned [3], SOLiD [4]

Mature rno-miR-124-3p

• Accession: MIMAT0000828
• Description: Rattus norvegicus rno-miR-124-3p mature miRNA
• Sequence: 53 - UAAGGCACGCGGUGAAUGCC - 72
• Evidence: experimental ; cloned [1-3], Northern [1], SOLiD [4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365


3. PubMed ID: 20403161
   Small RNA expression and strain specificity in the rat
   Linsen SE, de Wit E, de Bruijn E, Cuppen E
   BMC Genomics (2010) 11:249


4. PubMed ID: 15345052
   Microarray analysis of microRNA expression in the developing mammalian brain
   Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
   Genome Biol (2004) 5:R68