miRBase entry: rno-mir-145

Stem-loop rno-mir-145


Accession
MI0000918
Description
Rattus norvegicus rno-mir-145 precursor miRNA

Literature search
445 open access papers mention rno-mir-145
(1809 sentences)

Sequence

1143319 reads, 1060.0 reads per million, 493 experiments
caccuuguccucacgGUCCAGUUUUCCCAGGAAUCCCUuggaugcuaagaugggGAUUCCUGGAAAUACUGUUCUUgaggucauggcu
..((.((.(((((.((..((((.((.((((((((((((.............)))))))))))).)).))))..))))))).)).))..

Structure
ca  u  u     c  UC    U  C            uggau 
  cc ug ccuca gG  CAGU UU CCAGGAAUCCCU     g
  || || ||||| ||  |||| || ||||||||||||     c
  gg ac ggagU UC  GUCA AA GGUCCUUAGggg     u
uc  u  u     -  UU    U  A            uagaa 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr18: 56969907-56969994 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from rno-mir-145
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-145-5p

Accession MIMAT0000851
Description Rattus norvegicus rno-miR-145-5p mature miRNA
Sequence 16 - GUCCAGUUUUCCCAGGAAUCCCU - 38
Evidence experimental
cloned [1-3], SOLiD [4]

Mature rno-miR-145-3p

Accession MIMAT0017131
Description Rattus norvegicus rno-miR-145-3p mature miRNA
Sequence 55 - GAUUCCUGGAAAUACUGUUCUU - 76
Evidence experimental
SOLiD [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  4. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68