miRBase entry: rno-mir-194-1

Stem-loop rno-mir-194-1


Accession
MI0000937
Description
Rattus norvegicus rno-mir-194-1 precursor miRNA

Literature search
22 open access papers mention rno-mir-194-1
(131 sentences)

Sequence

1823991 reads, 2147 reads per million, 500 experiments
auggagucaucacgUGUAACAGCAACUCCAUGUGGAcugugcacagaucccaguggagcugcuguuacuuuugauggccucca
.(((((((((((...(((((((((.((((((..((((((....))).)))..)))))).)))))))))...)))))).)))))

Structure
a     -      cgU         A      GU   -   u 
 uggag ucauca   GUAACAGCA CUCCAU  GGA cug g
 ||||| ||||||   ||||||||| ||||||  ||| |||  
 accuc gguagu   cauugucgu gaggug  ccu gac c
-     c      uuu         c      ac   a   a 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr13: 103250576-103250658 [+]

Database links

Mature rno-miR-194-5p

Accession MIMAT0000869
Description Rattus norvegicus rno-miR-194-5p mature miRNA
Sequence 15 - UGUAACAGCAACUCCAUGUGGA - 36
Evidence experimental
cloned [1-2], SOLiD [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249