miRBase entry: rno-mir-195

Stem-loop rno-mir-195


Accession
MI0000939
Description
Rattus norvegicus rno-mir-195 precursor miRNA

Literature search
49 open access papers mention rno-mir-195
(241 sentences)

Sequence

322682 reads, 270 reads per million, 483 experiments
aacucuccuggcucUAGCAGCACAGAAAUAUUGGCacggguaagugagucugCCAAUAUUGGCUGUGCUGCUCCAggcaggguggug
.(((.(((((.((..((((((((((.((((((((((.((.(.....).))))))))))))..))))))))))..)).))))).))).

Structure
a   c     g  cU          -A          c  g a 
 acu uccug cu  AGCAGCACAG  AAUAUUGGCa gg u a
 ||| ||||| ||  ||||||||||  |||||||||| || | g
 ugg gggac gA  UCGUCGUGUC  UUAUAACCgu cu a u
g   u     g  CC          GG          -  g g 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr10: 56845301-56845387 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from rno-mir-195
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-195-5p

Accession MIMAT0000870
Description Rattus norvegicus rno-miR-195-5p mature miRNA
Sequence 15 - UAGCAGCACAGAAAUAUUGGC - 35
Evidence experimental
cloned [1-2], SOLiD [3]

Mature rno-miR-195-3p

Accession MIMAT0017149
Description Rattus norvegicus rno-miR-195-3p mature miRNA
Sequence 53 - CCAAUAUUGGCUGUGCUGCUCCA - 75
Evidence experimental
SOLiD [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249