miRBase entry: rno-mir-218a-1

Stem-loop rno-mir-218a-1


Accession
MI0000958
Description
Rattus norvegicus rno-mir-218a-1 precursor miRNA

Literature search
14 open access papers mention rno-mir-218a-1
(43 sentences)

Sequence

311503 reads, 229 reads per million, 480 experiments
gugauaacguagcgagauuuucugUUGUGCUUGAUCUAACCAUGUgcuugcgagguaugaguaAAACAUGGUUCCGUCAAGCACcauggaacgucacgcagcuuucuaca
(((..((.((.(((.(((.((((((.(((((((((..((((((((..((((.........)))).))))))))..))))))))).)))))).))).))).))))..))).

Structure
-   au  c  a   a   u      U         CU        gc    gag 
 gug  aa gu gcg gau uucugU GUGCUUGAU  AACCAUGU  uugc   g
 |||  || || ||| ||| |||||| |||||||||  ||||||||  ||||   u
 cau  uu cg cgc cug aaggua CACGAACUG  UUGGUACA  Aaug   a
a   cu  -  a   a   c      c         CC        -A    agu 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr14: 66923083-66923192 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from rno-mir-218a-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-218a-5p

Accession MIMAT0000888
Description Rattus norvegicus rno-miR-218a-5p mature miRNA
Sequence 25 - UUGUGCUUGAUCUAACCAUGU - 45
Evidence experimental
cloned [1-3], Northern [1-2], SOLiD [4]

Mature rno-miR-218a-1-3p

Accession MIMAT0017162
Description Rattus norvegicus rno-miR-218a-1-3p mature miRNA
Sequence 64 - AAACAUGGUUCCGUCAAGCAC - 84
Evidence experimental
SOLiD [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249