Stem-loop ath-MIR169e

Accession

MI0000979

Description

Arabidopsis thaliana ath-MIR169e precursor miRNA

Literature search

35 open access papers mention ath-MIR169e
(162 sentences)

Sequence

26206 reads, 182.0 reads per million, 182 experiments

ugaugaugaugaugagucacuaauuaauuguaucauagagucuugcauggaaaaauagaaaaugagauUGAGCCAAGGAUGACUUGCCGAuuuucucaacgaaucuuacugauuaugguauccgGCAAGUUGACUUUGGCUCUGUUuccuucccuucuuuucgaugucaaacucuagauaccuaaccacauaucauauauaucaucaucauucauca
(((((((((((((((..............(((((.((((((.((((((.(((((..((..((.(((((.(((((((((..(((((((((..(...(((...((((.....)))).))).)..)))))))))..))))))))).))))).))..))..))))).))).))))))))))))))........((((...)))).))))))))).))))))

Structure

      -         ------gucacuaauuaauu     a      c   -   g     au  aa  u     U         AU         Au uuc   acg    u 
ugauga ugaugauga                    guauc uagagu uug cau gaaaa  ag  aa gagau GAGCCAAGG  GACUUGCCG  u   uca   aauc u
|||||| |||||||||                    ||||| |||||| ||| ||| |||||  ||  || ||||| |||||||||  |||||||||  |   |||   |||| a
acuacu acuacuacu                    cauag aucuca aac gua cuuuu  uc  uu cuUUG CUCGGUUUC  UUGAACGgc  a   ggu   uuag c
      u         auauauacuauacaccaauc     -      -   u   g     cu  cc  c     U         AG         cu --u   --a    u 

Annotation confidence High

Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1], later experimentally verified [2]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context

chr1: 20041518-20041734 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from ath-MIR169e

Mature ath-miR169e-5p

• Accession: MIMAT0000909
• Description: Arabidopsis thaliana ath-miR169e-5p mature miRNA
• Sequence: 69 - UGAGCCAAGGAUGACUUGCCGA - 90
• Evidence: experimental ; cloned [2], 454 [3-4], MPSS [3], Illumina [5]

Mature ath-miR169e-3p

• Accession: MIMAT0053810
• Description: Arabidopsis thaliana ath-miR169e-3p mature miRNA
• Sequence: 125 - GCAAGUUGACUUUGGCUCUGUU - 146
• Evidence: experimental ; unknown

References

1. PubMed ID: 16040653
   Expression of Arabidopsis MIRNA genes
   "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
   "Plant Physiol (2005) 138:2145-2154


2. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


3. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


4. PubMed ID: 19815687
   Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
   "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
   "J Exp Bot (2010) 61:165-177


5. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799