Stem-loop ath-MIR169n

Accession

MI0000988

Description

Arabidopsis thaliana ath-MIR169n precursor miRNA

Literature search

37 open access papers mention ath-MIR169n
(165 sentences)

Sequence

74295 reads, 731.0 reads per million, 161 experiments

gaugaagaagagaggucuaacauggcggaaagcgucauguuuagUAGCCAAGGAUGACUUGCCUGAucuuuuucgccuccacgauucaauuucaaauucaugcauuuuggauuauuauaccuuuuaaaguauaauaggucaaauaucauguugaaucuugcggguuagguuucAGGCAGUCUCUUUGGCUAUCUugacaugcuuuuuccauccau
((((((((((....(((.(((((((((.....)))))))))..(((((((((((.((((.((((((....(((.((((.((.(((((((.........((((...(((((.(((((((((........))))))))).)))))...))))))))))).)).)))).)))..)))))))))))))))))))))...)))...)))))).))))...

Structure

---    -      agag   uaacauggcggaaagcgucauguuua           U    U      ucuu   c    c  c       uuucaaauu    cau     a         cuu 
   gaug aagaag    guc                          gUAGCCAAGGA GACU GCCUGA    uuu gccu ca gauucaa         caug   uuugg uuauuauac   u
   |||| ||||||    |||                          ||||||||||| |||| ||||||    ||| |||| || |||||||         ||||   ||||| |||||||||    
   cuac uuuuuc    cag                          UAUCGGUUUCU CUGA CGGAcu    gga uggg gu cuaaguu         guac   aaacu gauaauaug   u
uac    c      -gua   -----------------------uUC           -    -      --uu   u    c  u       ---------    uau     g         aaa 

Annotation confidence High

Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1], later experimentally verified [2]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context

chr3: 9878540-9878754 [-]

Clustered miRNAs

5 other miRNAs are < 10 kb from ath-MIR169n

Mature ath-miR169n-5p

• Accession: MIMAT0000919
• Description: Arabidopsis thaliana ath-miR169n-5p mature miRNA
• Sequence: 45 - UAGCCAAGGAUGACUUGCCUGA - 66
• Evidence: experimental ; 5'RACE [2], cloned [2], 454 [3-4], MPSS [3], Illumina [5]

Mature ath-miR169n-3p

• Accession: MIMAT0053817
• Description: Arabidopsis thaliana ath-miR169n-3p mature miRNA
• Sequence: 174 - AGGCAGUCUCUUUGGCUAUCU - 194
• Evidence: experimental ; unknown

References

1. PubMed ID: 16040653
   Expression of Arabidopsis MIRNA genes
   "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
   "Plant Physiol (2005) 138:2145-2154


2. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


3. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


4. PubMed ID: 19815687
   Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
   "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
   "J Exp Bot (2010) 61:165-177


5. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799