miRBase entry: ath-MIR172c

Stem-loop ath-MIR172c


Accession
MI0000991
Description
Arabidopsis thaliana ath-MIR172c precursor miRNA
Gene family
MIPF0000035; MIR172

Literature search
55 open access papers mention ath-MIR172c
(302 sentences)

Sequence

agcuacuguucgcuguuggagcaucaucaagauucacaaaucaucaaguauucguguaaauaaacccauuuaugauuagauuuuugauguauguaugAGAAUCUUGAUGAUGCUGCAGcugcaaucaguggcu
((((((((...((.((((.(((((((((((((((((((...(((((((.(((..(((((((......)))))))....))).)))))))..)))....)))))))))))))))).)))).))...))))))))

Structure
        uuc  u    g                ----   aau       u   --cg       aa 
agcuacug   gc guug agcaucaucaagauuc    aca   caucaag auu    uguaaau  a
||||||||   || |||| ||||||||||||||||    |||   ||||||| |||    |||||||   
ucggugac   cg cGAC UCGUAGUAGUUCUAAG    ugu   guaguuu uag    guauuua  c
        uaa  u    G                Agua   -au       u   auua       cc 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This sequence is a predicted paralogue of the previously identified miR172 family [1], later experimentally verified [2]. It is predicted to target mRNAs coding for APETALA2-like transcription factors.

Genome context
chr3: 3599776-3599908 [-]

Database links

Mature ath-miR172c

Accession MIMAT0000922
Description Arabidopsis thaliana ath-miR172c mature miRNA
Sequence 98 - AGAAUCUUGAUGAUGCUGCAG - 118
Evidence experimental
5'RACE [2], cloned [2], 454 [3-4], MPSS [3], Illumina [5]

References

  1. PubMed ID: 16040653
    Expression of Arabidopsis MIRNA genes
    "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
    "Plant Physiol (2005) 138:2145-2154

  2. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  3. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  4. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177

  5. PubMed ID: 15200956
    Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
    "Jones-Rhoades MW, Bartel DP"
    "Mol Cell (2004) 14:787-799