Stem-loop ath-MIR395c

Accession

MI0001009

Description

Arabidopsis thaliana ath-MIR395c precursor miRNA

Literature search

25 open access papers mention ath-MIR395c
(107 sentences)

Sequence

auguccacaugaguucccuuuaacgcuucauuguugaauacucaaagccacauugguuuguauauaacaCUGAAGUGUUUGGGGGGACUCuuggugucau
(((.(..((.((((((((((.(((((((((.(((((.((((...((((((...)))))))))).))))).))))))))).)))))))))).))..).)))

Structure

   u ca  u          u         u     a    uca      c 
aug c  ca gaguucccuu aacgcuuca uguug auac   aagcca  
||| |  || |||||||||| ||||||||| ||||| ||||   |||||| a
uac g  gu CUCAGGGGGG UUGUGAAGU acaau uaug   uuuggu  
   u ug  u          U         C     a    ---      u 

Annotation confidence Low

Comments

This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1].

Genome context

chr1: 9367080-9367179 [+]

Clustered miRNAs

2 other miRNAs are < 10 kb from ath-MIR395c

Mature ath-miR395c

• Accession: MIMAT0000940
• Description: Arabidopsis thaliana ath-miR395c mature miRNA
• Sequence: 70 - CUGAAGUGUUUGGGGGGACUC - 90
• Evidence: experimental ; 5'RACE [1-2], Northern [1], PCR [1], MPSS [3], 454 [4], Illumina [5]

References

1. PubMed ID: 16040653
   Expression of Arabidopsis MIRNA genes
   "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
   "Plant Physiol (2005) 138:2145-2154


2. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


3. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


4. PubMed ID: 19815687
   Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
   "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
   "J Exp Bot (2010) 61:165-177


5. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799