miRBase entry: ath-MIR398c

Stem-loop ath-MIR398c


Accession
MI0001019
Description
Arabidopsis thaliana ath-MIR398c precursor miRNA

Literature search
30 open access papers mention ath-MIR398c
(122 sentences)

Sequence


uggaucucgacAGGGUUGAUAUGAGAACACACgagcaaucaacggcuauaacgacgcuacgucauuguuacagcucucguuucaUGUGUUCUCAGGUCACCCCUGcugagcucuu
.(((.((((.(((((.((((.((((((((((((((........((((.((((((((...))))...)))).))))))))).....))))))))).)))).))))).)))).))).

Structure
u   u    a     U    A         -----     caaucaac    a    ---    c 
 gga cucg cAGGG UGAU UGAGAACAC     ACgag        ggcu uaac   gacg  
 ||| |||| ||||| |||| |||||||||     |||||        |||| ||||   |||| u
 ucu gagu GUCCC ACUG ACUCUUGUG     ugcuc        ucga auug   cugc  
u   c    c     C    G         Uacuu     --------    c    uua    a 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This sequence belongs to the miR398 family of miRNAs, which are predicted to target mRNAs coding for copper superoxide dismutases and cytochrome C oxidase subunit V [1].

Genome context
chr5: 4694694-4694808 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from ath-MIR398c
Name Accession Chromosome Start End Strand Confidence




Database links

Mature ath-miR398c-3p

Accession MIMAT0000950
Description Arabidopsis thaliana ath-miR398c-3p mature miRNA
Sequence 85 - UGUGUUCUCAGGUCACCCCUG - 105
Evidence experimental
5'RACE [1,3], Northern [1-2], PCR [1], cloned [2-3], 454 [4-5], MPSS [4]

Mature ath-miR398c-5p

Accession MIMAT0031912
Description Arabidopsis thaliana ath-miR398c-5p mature miRNA
Sequence 12 - AGGGUUGAUAUGAGAACACAC - 32
Evidence not_experimental

References

  1. PubMed ID: 16040653
    Expression of Arabidopsis MIRNA genes
    "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
    "Plant Physiol (2005) 138:2145-2154

  2. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  3. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  4. PubMed ID: 15200956
    Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
    "Jones-Rhoades MW, Bartel DP"
    "Mol Cell (2004) 14:787-799

  5. PubMed ID: 15258262
    Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis
    "Sunkar R, Zhu JK"
    "Plant Cell (2004) 16:2001-2019