miRBase entry: ath-MIR399d

Stem-loop ath-MIR399d


Accession
MI0001023
Description
Arabidopsis thaliana ath-MIR399d precursor miRNA
Gene family
MIPF0000015; MIR399

Literature search
37 open access papers mention ath-MIR399d
(207 sentences)

Sequence

gguuggauuacugggcgaauacuccuauggcagaucgcauuggcuagauaugcaaguaaaaugcuucucUGCCAAAGGAGAUUUGCCCCGcaauucaucc
((.((((((.(.((((((((.(((((.(((((((..(((((.(((.(.....).)))..)))))...))))))).))))))))))))).).)))))).))

Structure
  u      a u        a     a       -uc     -g   a a 
gg uggauu c gggcgaau cuccu uggcaga   gcauu  gcu g u
|| |||||| | |||||||| ||||| |||||||   |||||  ||| | a
cc acuuaa G CCCGUUUA GAGGA ACCGUcu   cguaa  uga c u
  u      c C        -     A       cuu     aa   a g 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context
chr2: 14442978-14443077 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from ath-MIR399d
Name Accession Chromosome Start End Strand Confidence




Database links

Mature ath-miR399d

Accession MIMAT0000954
Description Arabidopsis thaliana ath-miR399d mature miRNA
Sequence 70 - UGCCAAAGGAGAUUUGCCCCG - 90
Evidence experimental
PCR [1], 5'RACE [2], 454 [3-4], MPSS [3], Illumina [5]

References

  1. PubMed ID: 16040653
    Expression of Arabidopsis MIRNA genes
    "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
    "Plant Physiol (2005) 138:2145-2154

  2. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  3. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  4. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177

  5. PubMed ID: 15200956
    Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
    "Jones-Rhoades MW, Bartel DP"
    "Mol Cell (2004) 14:787-799