miRBase entry: ath-MIR399f

Stem-loop ath-MIR399f


Accession
MI0001025
Description
Arabidopsis thaliana ath-MIR399f precursor miRNA

Literature search
35 open access papers mention ath-MIR399f
(174 sentences)

Sequence

auaugcauuacagggcaagaucaccauuggcagagaucuauuacuucauucuugcaucauaugcauaaauguuuguggugagcucucUGCCAAAGGAGAUUUGCCCGGuaauucucuu
......(((((.(((((.((((.((.((((((((((.(((((((..((((..(((((...)))))..))))...))))).)).)))))))))).)).))))))))).)))))......

Structure
auaugc     a     a    a  a          u  -     -uu    cu     c 
      auuac gggca gauc cc uuggcagaga cu auuac   cauu  ugcau  
      ||||| ||||| |||| || |||||||||| || |||||   ||||  ||||| a
      uaauG CCCGU UUAG GG AACCGUcucu ga uggug   guaa  acgua  
uucucu     G     -    A  A          c  g     uuu    au     u 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context
chr2: 14444997-14445114 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from ath-MIR399f
Name Accession Chromosome Start End Strand Confidence




Database links

Mature ath-miR399f

Accession MIMAT0000956
Description Arabidopsis thaliana ath-miR399f mature miRNA
Sequence 88 - UGCCAAAGGAGAUUUGCCCGG - 108
Evidence experimental
PCR [1], cloned [2], Northern [2], 454 [3-4], MPSS [3], Illumina [5]

References

  1. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  2. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  3. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177

  4. PubMed ID: 15200956
    Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
    "Jones-Rhoades MW, Bartel DP"
    "Mol Cell (2004) 14:787-799

  5. PubMed ID: 15258262
    Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis
    "Sunkar R, Zhu JK"
    "Plant Cell (2004) 16:2001-2019