Stem-loop osa-MIR395h

Accession

MI0001032

Description

Oryza sativa osa-MIR395h precursor miRNA

Literature search

39 open access papers mention osa-MIR395h
(173 sentences)

Sequence

26 reads, 18 reads per million, 2 experiments

uuguuaccuggaguuuccucaacacacuucacaucugcuaggcccuauuacaauugcgcaauguggagucugcaauugguaGUGAAGUGUUUGGGGGAACUCuagguggcac
.(((((((((((((((((((((.(((((((((((((((.((((((((((.(......).)))).)).)))))))...))).)))))))))))))))))))))))))))))).

Structure

u                     c         -   ---   u    -  -    a aa 
 uguuaccuggaguuuccucaa acacuucac auc   ugc aggc cc uauu c  u
 ||||||||||||||||||||| ||||||||| |||   ||| |||| || |||| |   
 acgguggauCUCAAGGGGGUU UGUGAAGUG ugg   acg ucug gg guaa g  u
c                     -         a   uua   -    a  u    c cg 

Annotation confidence Not enough data

Comments

This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1]. Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the genes have been renamed to reflect this arrangement [2].

Genome context

Chr8: 3299144-3299255 [+]

Clustered miRNAs

5 other miRNAs are < 10 kb from osa-MIR395h

Mature osa-miR395h

• Accession: MIMAT0000963
• Description: Oryza sativa osa-miR395h mature miRNA
• Sequence: 82 - GUGAAGUGUUUGGGGGAACUC - 102
• Evidence: not_experimental

References

1. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799


2. PubMed ID: 16117853
   Molecular evolution of the rice miR395 gene family
   "Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L"
   "Cell Res (2005) 15:631-638