Stem-loop osa-MIR395j

Accession

MI0001034

Description

Oryza sativa osa-MIR395j precursor miRNA

Literature search

39 open access papers mention osa-MIR395j
(167 sentences)

Sequence

26 reads, 18 reads per million, 2 experiments

guguucccaagaguuccuugcaagcacuucacauagaacuucuguuacucucauguaacauugggaacuugagaagcuacuGUGAAGUGUUUGGGGGAACUCuagguggcac
(((((.((.((((((((((.((((((((((((((((..(((((.....(((((........))))).....)))))))).))))))))))))))))))))))).)).)))))

Structure

     c  a          g             -   aa     guuac     ugu 
guguu cc agaguuccuu caagcacuucaca uag  cuucu     ucuca   a
||||| || |||||||||| ||||||||||||| |||  |||||     |||||    
cacgg gg uCUCAAGGGG GUUUGUGAAGUGu auc  gaaga     agggu   a
     u  a          -             c   --     guuca     uac 

Annotation confidence Not enough data

Comments

This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1]. Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the genes have been renamed to reflect this arrangement [2].

Genome context

Chr8: 3299479-3299590 [+]

Clustered miRNAs

5 other miRNAs are < 10 kb from osa-MIR395j

Mature osa-miR395j

• Accession: MIMAT0000965
• Description: Oryza sativa osa-miR395j mature miRNA
• Sequence: 82 - GUGAAGUGUUUGGGGGAACUC - 102
• Evidence: not_experimental

References

1. PubMed ID: 15200956
   Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
   "Jones-Rhoades MW, Bartel DP"
   "Mol Cell (2004) 14:787-799


2. PubMed ID: 16117853
   Molecular evolution of the rice miR395 gene family
   "Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L"
   "Cell Res (2005) 15:631-638