miRBase entry: ath-MIR403

Stem-loop ath-MIR403


Accession
MI0001072
Description
Arabidopsis thaliana ath-MIR403 precursor miRNA

Literature search
7 open access papers mention ath-MIR403
(9 sentences)

Sequence


uugucauuagaagagucguauuacaUGUUUUGUGCUUGAAUCUAAUUcaacaggcuuuauguaagagauucuuuaacaauuccuauaaucuuuguuguuggaUUAGAUUCACGCACAAACUCGuaaucugucuuu
...........((((.((.(((((..((((.((((.(((((((((((((((((((.....)).(((((((................))))))).))))))))))))))))).))))))))..))))).)).))))

Structure
uugucauuaga    u  u     aU    U    U                 gcuuuaugua       cuuuaac 
           agag cg auuac  GUUU GUGC UGAAUCUAAUUcaacag          agagauu       a
           |||| || |||||  |||| |||| |||||||||||||||||          |||||||        
           uuuc gu uaauG  CAAA CACG ACUUAGAUUagguuguu          uuucuaa       a
-----------    u  c     CU    -    C                 ---------g       uauccuu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr2: 19415052-19415186 [+]

Database links

Mature ath-miR403-3p

Accession MIMAT0001004
Description Arabidopsis thaliana ath-miR403-3p mature miRNA
Sequence 103 - UUAGAUUCACGCACAAACUCG - 123
Evidence experimental
cloned [1-2], Northern [1], 3'RACE [2], 5'RACE [2], 454 [3-4], MPSS [3], Illumina [5]

Mature ath-miR403-5p

Accession MIMAT0031914
Description Arabidopsis thaliana ath-miR403-5p mature miRNA
Sequence 26 - UGUUUUGUGCUUGAAUCUAAUU - 47
Evidence not_experimental

References

  1. PubMed ID: 16040653
    Expression of Arabidopsis MIRNA genes
    "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
    "Plant Physiol (2005) 138:2145-2154

  2. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  3. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  4. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177

  5. PubMed ID: 15258262
    Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis
    "Sunkar R, Zhu JK"
    "Plant Cell (2004) 16:2001-2019