WARNING: This summary was generated by AI. MIR196B, a microRNA, was chosen for detailed examination in the context of colorectal cancer due to its potential role in gene regulation [PMC4413621]. It shares a targeting relationship with MIR196A, both of which influence the gene HOXA5 [PMC3742271]. To elucidate the spectrum of MIR196B's target genes, researchers employed mRNA microarray analysis coupled with bioinformatics tools [PMC4413621]. Additionally, the study explored MIR196B's regulatory impact on both mRNA and protein levels of FAS in SW480 colorectal cancer cells [PMC4413621].
-- uc uU U C ucca acugg ggugau AGGUAGU UC UGUUGUUGGGa c ||||| |||||| ||||||| || ||||||||||| ugacu ucauua UCCGUCA AG ACGACAGCUcu c gu -- CU C C cuuu
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0001080 |
| Description | Homo sapiens hsa-miR-196b-5p mature miRNA |
| Sequence | 15 - UAGGUAGUUUCCUGUUGUUGGG - 36 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0009201 |
| Description | Homo sapiens hsa-miR-196b-3p mature miRNA |
| Sequence | 50 - UCGACAGCACGACACUGCCUUC - 71 |
| Evidence |
experimental
454 [4] |
| Database links |
|
| Predicted targets |
|
|