miRBase entry: hsa-mir-196b

Stem-loop hsa-mir-196b


Accession
MI0001150
Symbol
HGNC: MIR196B
Description
Homo sapiens hsa-mir-196b precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR196B, a microRNA, was chosen for detailed examination in the context of colorectal cancer due to its potential role in gene regulation [PMC4413621]. It shares a targeting relationship with MIR196A, both of which influence the gene HOXA5 [PMC3742271]. To elucidate the spectrum of MIR196B's target genes, researchers employed mRNA microarray analysis coupled with bioinformatics tools [PMC4413621]. Additionally, the study explored MIR196B's regulatory impact on both mRNA and protein levels of FAS in SW480 colorectal cancer cells [PMC4413621].

Literature search
163 open access papers mention hsa-mir-196b
(815 sentences)

Sequence

320705 reads, 843 reads per million, 147 experiments
acuggucggugauuUAGGUAGUUUCCUGUUGUUGGGauccaccuuucucUCGACAGCACGACACUGCCUUCauuacuucaguug
(((((..((((((..(((((((.((.(((((((((((..........))))))))))).)).)))))))..)))))))))))..

Structure
--     uc      uU       U  C           ucca 
  acugg  ggugau  AGGUAGU UC UGUUGUUGGGa    c
  |||||  ||||||  ||||||| || |||||||||||     
  ugacu  ucauua  UCCGUCA AG ACGACAGCUcu    c
gu     --      CU       C  C           cuuu 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-196b is predicted based on sequence homology to miR-196a [1]. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr7: 27169480-27169563 [-]

Disease association
hsa-mir-196b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-196b-5p

Accession MIMAT0001080
Description Homo sapiens hsa-miR-196b-5p mature miRNA
Sequence 15 - UAGGUAGUUUCCUGUUGUUGGG - 36
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-196b-3p

Accession MIMAT0009201
Description Homo sapiens hsa-miR-196b-3p mature miRNA
Sequence 50 - UCGACAGCACGACACUGCCUUC - 71
Evidence experimental
454 [4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 19144710
    Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas
    "Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G"
    "J Virol (2009) 83:3333-3341

  4. PubMed ID: 15105502
    MicroRNA-directed cleavage of HOXB8 mRNA
    "Yekta S, Shih IH, Bartel DP"
    "Science (2004) 304:594-596