miRBase entry: mmu-mir-196b

Stem-loop mmu-mir-196b


Accession
MI0001151
Symbol
MGI: Mir196b
Description
Mus musculus mmu-mir-196b precursor miRNA

Literature search
50 open access papers mention mmu-mir-196b
(250 sentences)

Sequence

281485 reads, 1769 reads per million, 85 experiments
aacuggucggugauuUAGGUAGUUUCCUGUUGUUGGGauccaccuuucucUCGACAGCACGACACUGCCUUCauuacuucaguug
((((((..((((((..(((((((.((.(((((((((((..........))))))))))).)).)))))))..)))))))))))).

Structure
-      uc      uU       U  C           ucca 
 aacugg  ggugau  AGGUAGU UC UGUUGUUGGGa    c
 ||||||  ||||||  ||||||| || |||||||||||     
 uugacu  ucauua  UCCGUCA AG ACGACAGCUcu    c
g      --      CU       C  C           cuuu 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-196b is predicted based on sequence homology to miR-196a [1]. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [1]. Landgraf et al. confirm expression of miR-196b in mouse by cloning [2].

Genome context
chr6: 52230081-52230165 [-]

Database links

Mature mmu-miR-196b-5p

Accession MIMAT0001081
Description Mus musculus mmu-miR-196b-5p mature miRNA
Sequence 16 - UAGGUAGUUUCCUGUUGUUGGG - 37
Evidence experimental
cloned [2], Illumina [3,5]
Database links
Predicted targets

Mature mmu-miR-196b-3p

Accession MIMAT0017170
Description Mus musculus mmu-miR-196b-3p mature miRNA
Sequence 51 - UCGACAGCACGACACUGCCUUC - 72
Evidence experimental
454 [4], Illumina [5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275

  5. PubMed ID: 15105502
    MicroRNA-directed cleavage of HOXB8 mRNA
    "Yekta S, Shih IH, Bartel DP"
    "Science (2004) 304:594-596