Stem-loop mmu-mir-409

Accession

MI0001160

Symbol

MGI: Mir409

Description

Mus musculus mmu-mir-409 precursor miRNA

Literature search

19 open access papers mention mmu-mir-409
(127 sentences)

Sequence

83081 reads, 373 reads per million, 87 experiments

ugguacucggagagAGGUUACCCGAGCAACUUUGCAUcuggaggacGAAUGUUGCUCGGUGAACCCCUuuucgguauca
((((((.(((((((.((((..((((((((((((((........).)))).)))))))))..)))).)))))))))))))

Structure

      u       A    AC         -    - AUc 
ugguac cggagag GGUU  CCGAGCAAC UUUG C   u
|||||| ||||||| ||||  ||||||||| |||| |    
acuaug gcuuuUC CCAA  GGCUCGUUG AAGc g   g
      -       C    GU         U    a gag 

Annotation confidence Medium

Comments

Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse, including the miR-409-5p [1]. The 3' end of miR-409-5p was not determined and is predicted based on a miRNA length of 23 nts. Landgraf et al. later confirm expression of mature miRNAs from both arms of the hairpin [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

chr12: 109743158-109743236 [+]

Clustered miRNAs

13 other miRNAs are < 10 kb from mmu-mir-409

Mature mmu-miR-409-5p

• Accession: MIMAT0004746
• Description: Mus musculus mmu-miR-409-5p mature miRNA
• Sequence: 15 - AGGUUACCCGAGCAACUUUGCAU - 37
• Evidence: experimental ; cloned [3], Illumina [4-5]

Mature mmu-miR-409-3p

• Accession: MIMAT0001090
• Description: Mus musculus mmu-miR-409-3p mature miRNA
• Sequence: 47 - GAAUGUUGCUCGGUGAACCCCU - 68
• Evidence: experimental ; PCR [1], cloned [2-3], Illumina [4-5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


3. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


4. PubMed ID: 15310658
   A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain
   "Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J"
   "Genome Res (2004) 14:1741-1748


5. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267