miRBase entry: mmu-mir-409

Stem-loop mmu-mir-409


Accession
MI0001160
Symbol
MGI: Mir409
Description
Mus musculus mmu-mir-409 precursor miRNA

Literature search
19 open access papers mention mmu-mir-409
(127 sentences)

Sequence

83081 reads, 373 reads per million, 87 experiments
ugguacucggagagAGGUUACCCGAGCAACUUUGCAUcuggaggacGAAUGUUGCUCGGUGAACCCCUuuucgguauca
((((((.(((((((.((((..((((((((((((((........).)))).)))))))))..)))).)))))))))))))

Structure
      u       A    AC         -    - AUc 
ugguac cggagag GGUU  CCGAGCAAC UUUG C   u
|||||| ||||||| ||||  ||||||||| |||| |    
acuaug gcuuuUC CCAA  GGCUCGUUG AAGc g   g
      -       C    GU         U    a gag 


Annotation confidence High
Do you think this miRNA is real?
Comments
Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse, including the miR-409-5p [1]. The 3' end of miR-409-5p was not determined and is predicted based on a miRNA length of 23 nts. Landgraf et al. later confirm expression of mature miRNAs from both arms of the hairpin [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr12: 109743158-109743236 [+]
Clustered miRNAs
13 other miRNAs are < 10 kb from mmu-mir-409
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-409-5p

Accession MIMAT0004746
Description Mus musculus mmu-miR-409-5p mature miRNA
Sequence 15 - AGGUUACCCGAGCAACUUUGCAU - 37
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-409-3p

Accession MIMAT0001090
Description Mus musculus mmu-miR-409-3p mature miRNA
Sequence 47 - GAAUGUUGCUCGGUGAACCCCU - 68
Evidence experimental
PCR [1], cloned [2-3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 15310658
    A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain
    "Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J"
    "Genome Res (2004) 14:1741-1748

  5. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267