miRBase entry: mmu-mir-376b

Stem-loop mmu-mir-376b


Accession
MI0001162
Symbol
MGI: Mir376b
Description
Mus musculus mmu-mir-376b precursor miRNA mir-368
Gene
family?
RF04291; mir-368

Literature search
23 open access papers mention mmu-mir-376b
(47 sentences)

Sequence

42584 reads, 443 reads per million, 75 experiments
ugguauuuaaaagGUGGAUAUUCCUUCUAUGGUUAcgugcuuccuggauaAUCAUAGAGGAACAUCCACUUuuucaguauca
(((((((.(((((((((((.(((((.((((((((((..........).)))))))))))))).))))))))))).)))))))

Structure
       u           A     U         - gugc 
ugguauu aaaagGUGGAU UUCCU CUAUGGUUA c    u
||||||| ||||||||||| ||||| ||||||||| |     
acuauga uuuUUCACCUA AAGGA GAUACUAau g    u
       c           C     -         a gucc 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The mature miR-376b products have been shown to be modified by A to I edits [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chr12: 109723458-109723539 [+]
Clustered miRNAs
16 other miRNAs are < 10 kb from mmu-mir-376b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-376b-5p

Accession MIMAT0003388
Description Mus musculus mmu-miR-376b-5p mature miRNA
Sequence 14 - GUGGAUAUUCCUUCUAUGGUUA - 35
Evidence experimental
cloned [2,4], Illumina [5-6]
Database links
Predicted targets

Mature mmu-miR-376b-3p

Accession MIMAT0001092
Description Mus musculus mmu-miR-376b-3p mature miRNA
Sequence 51 - AUCAUAGAGGAACAUCCACUU - 71
Evidence experimental
Northern [1], PCR [1], cloned [2,4], Illumina [5-6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 15310658
    A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain
    "Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J"
    "Genome Res (2004) 14:1741-1748

  5. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267

  6. PubMed ID: 17322061
    Redirection of silencing targets by adenosine-to-inosine editing of miRNAs
    "Kawahara Y, Zinshteyn B, Sethupathy P, Iizasa H, Hatzigeorgiou AG, Nishikura K"
    "Science (2007) 315:1137-1140