miRBase entry: mmu-mir-412

Stem-loop mmu-mir-412


Accession
MI0001164
Symbol
MGI: Mir412
Description
Mus musculus mmu-mir-412 precursor miRNA mir-412
Gene
family?
RF00762; mir-412

Literature search
7 open access papers mention mmu-mir-412
(36 sentences)

Sequence

3167 reads, 35 reads per million, 48 experiments
ggguaugggacggaUGGUCGACCAGCUGGAAAGUAAUuguuucuaauguacUUCACCUGGUCCACUAGCCGucggugccc
((((((..(((((.((((.((((((.(((..((((((((....)))).))))))).)))))).)))).))))).))))))

Structure
      gg     a    C      C   AA    -    u 
ggguau  gacgg UGGU GACCAG UGG  AGUA AUug u
||||||  ||||| |||| |||||| |||  |||| ||||  
cccgug  cuGCC AUCA CUGGUC ACU  Ucau uaau u
      -g     G    C      C   --    g    c 


Annotation confidence High
Do you think this miRNA is real?
Comments
Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr12: 109743289-109743368 [+]
Clustered miRNAs
13 other miRNAs are < 10 kb from mmu-mir-412
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-412-5p

Accession MIMAT0017173
Description Mus musculus mmu-miR-412-5p mature miRNA
Sequence 15 - UGGUCGACCAGCUGGAAAGUAAU - 37
Evidence experimental
Illumina [5]
Database links
Predicted targets

Mature mmu-miR-412-3p

Accession MIMAT0001094
Description Mus musculus mmu-miR-412-3p mature miRNA
Sequence 52 - UUCACCUGGUCCACUAGCCG - 71
Evidence experimental
PCR [1], cloned [2-3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 15310658
    A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain
    "Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J"
    "Genome Res (2004) 14:1741-1748

  5. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267