Gga-mir-33 is a microRNA found in chickens that plays a role in regulating fatty acid oxidation in the liver [PMC7936154]. It is homologous to gga-mir-33* [PMC3005926]. Studies have shown that gga-mir-33 targets enzymes involved in fatty acid oxidation, such as CROT, HADHB, and FTO [PMC7936154]. In the liver of newly hatched chicks subjected to a delay in feeding, the expression of gga-mir-33 is significantly lower compared to chicks that were fed from hatch [PMC7936154]. This suggests that gga-mir-33 may negatively regulate fatty acid oxidation when chicks rely on residual yolk lipids for energy production [PMC7936154'>PMC7936154]. The expression of gga-mir-33 increases from hatching through the first weeks of posthatch life [PMC7936154]. It has been predicted that gga-mir-33 targets various enzymes involved in metabolic signaling cascades and effector enzymes related to lipid metabolism [PMC7936154]. Gga-mir-33 has been found to regulate fat mass and obesity-associated (FTO) genes associated with obesity in chicken liver, similar to its function in mammals such as humans and mice [PMC7084605]. Studies have shown that gga-mir-33 is closely related to lipid metabolism and fatty acid oxidation by regulating FTO, CROT, and HADHB genes in chicken liver [PMC9714206]. Furthermore, gga-mir-33 and its host gene SREBF2 are highly expressed in the chicken liver, suggesting their involvement in upregulating genes related to cholesterol biosynthesis [PMC3675212].
G UU --g g cugua UGCAUUGUAG GCAUUGCau ugcu ||||| |||||||||| ||||||||| |||| g gacAU ACGUGACGUC UGUAAcgug auga G CU uca c
Accession | MIMAT0001100 |
Description | Gallus gallus gga-miR-33-5p mature miRNA |
Sequence | 6 - GUGCAUUGUAGUUGCAUUGC - 25 |
Evidence |
experimental
cloned [1-2], Illumina [3] |
Database links |
![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026490 |
Description | Gallus gallus gga-miR-33-3p mature miRNA |
Sequence | 47 - AAUGUUCCUGCAGUGCAGUA - 66 |
Evidence |
experimental
Illumina [3] |
Database links |
![]() |
Predicted targets |
![]() ![]() |
|