Stem-loop osa-MIR416

Accession

MI0001436

Description

Oryza sativa osa-MIR416 precursor miRNA

Literature search

4 open access papers mention osa-MIR416
(6 sentences)

Sequence

gaugaggaguaugaauagaaagaauuagaaaagcuacggugguuguugagcagcgccaaaaaaaacucugcuuugcucuguuucugUGUUCGUCCGUACACUGUUCAuc
((((((.((((((((((...((((.(((((((((...((((.((((...))))))))............)))))..)))).)))).)))))))......))).))))))

Structure

      g   ------       gaa    u    --     ---------uac    g    u 
gaugag agu      augaaua   agaa uaga  aaagc            ggug uugu  
|||||| |||      |||||||   |||| ||||  |||||            |||| |||| g
cuACUU UCA      UGCUUGU   ucuu gucu  uuucg            ccgc gacg  
      G   CAUGCC       --g    u    cg     ucucaaaaaaaa    -    a 

Annotation confidence Not enough data

Comments

The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context

Chr4: 17456166-17456274 [+]

Mature osa-miR416

• Accession: MIMAT0001332
• Description: Oryza sativa osa-miR416 mature miRNA
• Sequence: 87 - UGUUCGUCCGUACACUGUUCA - 107
• Evidence: not_experimental

References

1. PubMed ID: 15345049
   Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets
   Wang XJ, Reyes JL, Chua NH, Gaasterland T
   Genome Biol (2004) 5:R65


2. PubMed ID: 16669754
   MicroRNAS and their regulatory roles in plants
   "Jones-Rhoades MW, Bartel DP, Bartel B"
   "Annu Rev Plant Biol (2006) 57:19-53