MIR424 is a type of microRNA that has been studied in relation to tumours [PMC8007794]. In tumours larger than 5 cm, the expression of MIR424 was found to be significantly decreased [PMC8007794]. Additionally, the concentration of MIR424, which is the ortholog of rat miR322, was observed to decline shortly after the induction of vascular smooth muscle cell (vSMC) proliferation and then increase [PMC7123062]. These findings suggest that MIR424 may play a role in tumour development and vSMC proliferation [PMC8007794] [PMC7123062]. Further research is needed to fully understand the mechanisms and implications of MIR424 in these processes [PMC8007794] [PMC7123062].
--------------------- a C AA g c cgagggg ua AGCAGC UUCAUGUUUUGAA uguu ||||||| || |||||| ||||||||||||| |||| u gcucccc aU UCGUCG GAGUGCAAAACuu guaa gggguggaagauggaaggggu c A CG g a
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0001341 |
Description | Homo sapiens hsa-miR-424-5p mature miRNA |
Sequence | 11 - CAGCAGCAAUUCAUGUUUUGAA - 32 |
Evidence |
experimental
cloned [1-2], Northern [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004749 |
Description | Homo sapiens hsa-miR-424-3p mature miRNA |
Sequence | 48 - CAAAACGUGAGGCGCUGCUAU - 68 |
Evidence |
experimental
cloned [2-3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|