WARNING: This summary was generated by AI. MIR424, which is the ortholog of rat miR322, is a microRNA involved in the regulation of various cellular processes [PMC7123062]. In the context of tumor growth, a significant reduction in MIR424 expression has been observed in tumors that exceed 5 cm in diameter [PMC8007794]. This decrease in MIR424 levels appears to be temporally associated with the induction of vascular smooth muscle cell (vSMC) proliferation, as its concentration initially drops following this cellular event but subsequently increases [PMC7123062]. The dynamic expression pattern of MIR424 suggests a potential role in tumor progression and cellular proliferation processes [PMC8007794; PMC7123062]..
--------------------- a C AA g c
cgagggg ua AGCAGC UUCAUGUUUUGAA uguu
||||||| || |||||| ||||||||||||| |||| u
gcucccc aU UCGUCG GAGUGCAAAACuu guaa
gggguggaagauggaaggggu c A CG g a
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0001341 |
| Description | Homo sapiens hsa-miR-424-5p mature miRNA |
| Sequence | 11 - CAGCAGCAAUUCAUGUUUUGAA - 32 |
| Evidence |
experimental
cloned [1-2], Northern [1] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004749 |
| Description | Homo sapiens hsa-miR-424-3p mature miRNA |
| Sequence | 48 - CAAAACGUGAGGCGCUGCUAU - 68 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
|