miRBase entry: hsa-mir-425

Stem-loop hsa-mir-425


Accession
MI0001448
Symbol
HGNC: MIR425
Description
Homo sapiens hsa-mir-425 precursor miRNA mir-425
Gene
family?
RF00803; mir-425

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR425 is a differentially expressed microRNA (miRNA) that has been studied in various biological contexts, including cancer and heart disease. In a study focusing on testicular development, MIR425 was among nine miRNAs selected for validation by RT-qPCR in calf and bull testes [PMC9777600]. It has been implicated in breast cancer, where it was found to be generally downregulated in serum samples [PMC9967215], and it is recognized as a regulator of tumorigenesis [PMC5361868]. MIR425 has also been associated with the regulation of the ubiquitin-like protein UBQLN1, although overexpression experiments did not show an effect on UBQLN1 levels [PMC5361868]. In genetic studies involving mice, homozygosity for a MIR425 deletion was found to be lethal, suggesting an essential role for this miRNA in development or survival [PMC8520725]. Furthermore, MIR425 is expressed in cumulus cells (CCs) and has been implicated as a potential biomarker for various cancers including cervical cancer and pancreatic ductal adenocarcinoma (PDAC) [PMC8316837; PMC9599289].. It also plays a role in the regulation of cardiac gene expression and may serve as an early biomarker for heart conditions such as hypertrophic cardiomyopathy and heart failure [PMC9897690; PMC8773242].. Lastly, MIR425 is considered among potential endogenous controls for gene expression studies involving whole blood samples due to its stable expression levels [PMC6172720].

Literature search
51 open access papers mention hsa-mir-425
(291 sentences)

Sequence

219172 reads, 1627 reads per million, 150 experiments
gaaagcgcuuuggAAUGACACGAUCACUCCCGUUGAgugggcacccgagaagccAUCGGGAAUGUCGUGUCCGCCCagugcucuuuc
(((((.((.((((...(((((((.((.(((((....((((............))))))))).)))))))))...)))).)).)))))

Structure
     c  u    AAU       U  C     UUGA    gcacc 
gaaag gc uugg   GACACGA CA UCCCG    gugg     c
||||| || ||||   ||||||| || |||||    ||||      
cuuuc cg gaCC   CUGUGCU GU AGGGC    UAcc     g
     u  u    CGC       -  A     ----    gaaga 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequences were previously named miR-425-5p and miR-425-3p in [2] and here. Landgraf et al. show that the 5' product is the predominant one [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr3: 49020148-49020234 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-425
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-425 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-425-5p

Accession MIMAT0003393
Description Homo sapiens hsa-miR-425-5p mature miRNA
Sequence 14 - AAUGACACGAUCACUCCCGUUGA - 36
Evidence experimental
cloned [2-4]
Database links
Predicted targets

Mature hsa-miR-425-3p

Accession MIMAT0001343
Description Homo sapiens hsa-miR-425-3p mature miRNA
Sequence 55 - AUCGGGAAUGUCGUGUCCGCCC - 76
Evidence experimental
cloned [2-3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706