MIR425 is a differentially expressed (DE) microRNA (miRNA) that has been studied in various biological contexts. It has been identified as one of the DE miRNAs in calf and bull testes, along with MIR98, MIR34C, MIR184, MIR18A, MIR136, MIR15A, MIR1388, and MIR210 [PMC9777600]. In breast cancer cells, it has been shown that the long non-coding RNA LINC00899 directly interacts with and binds to MIR425 [PMC6914403]. In the context of breast cancer cases versus controls, the ratio of microRNA concentrations for MIR425 was found to be downregulated in serum samples [PMC9967215]. Additionally, it has been identified as a potential biomarker for breast cancer along with other miRNAs such as MIR21 and MIR155 [PMC9967215]. In tumorigenesis regulation studies, both in vitro and in silico approaches have implicated the involvement of miR425 [PMC5361868]. Furthermore, studies have shown that homozygosity for a deletion involving the gene encoding for miR425 is lethal in mice [PMC8520725]. In other cancer types such as cervical cancer and gastric cancer cells, miR425 has also been implicated as a potential biomarker or regulator [PMC8316837] [PMC7238808]. Additionally, it has been proposed as a potential biomarker for pancreatic ductal adenocarcinoma (PDAC) detection along with other miRNAs such as miR31 and miR93 [PMC9599289]. Furthermore, downregulation of miR425 expression has also been observed in hypertrophic cardiomyopathy and myocardial infarction cases [PMC8773242] [PMC9897690].
c u AAU U C UUGA gcacc gaaag gc uugg GACACGA CA UCCCG gugg c ||||| || |||| ||||||| || ||||| |||| cuuuc cg gaCC CUGUGCU GU AGGGC UAcc g u u CGC - A ---- gaaga
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003393 |
Description | Homo sapiens hsa-miR-425-5p mature miRNA |
Sequence | 14 - AAUGACACGAUCACUCCCGUUGA - 36 |
Evidence |
experimental
cloned [2-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0001343 |
Description | Homo sapiens hsa-miR-425-3p mature miRNA |
Sequence | 55 - AUCGGGAAUGUCGUGUCCGCCC - 76 |
Evidence |
experimental
cloned [2-3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|