WARNING: This summary was generated by AI. MIR18B is a microRNA implicated in various biological processes and diseases, including cancer and systematic diseases like PCOS [PMC3544584]. In PCOS, a condition affecting women's reproductive and metabolic systems, MIR18B is among the microRNAs that are upregulated in the follicular fluid, suggesting its potential role in the pathophysiology of the disease [PMC6956659]. Additionally, MIR18B has been identified as a regulator of the MDM2-p53 pathway, which is crucial for cell cycle control and apoptosis [PMC9791775]. Its expression has been documented as a significant cell cycle regulator in a cyclin-independent manner [PMC9555085], and it is part of a human cluster of miRNAs that includes MIR363, MIR19A2, MIR19B2, MIR20B, and MIR106A [PMC3576234]. In inflammatory conditions and among centenarians, its expression remains poorly characterized [PMC7432402], while it also appears to regulate cell cycle proteins independently of cyclins [PMC6096428]. In cancer contexts like triple-negative breast cancer (TNBC), under-expression of MIR18B has been observed in urine samples compared to healthy controls [PMC9864244], while its expression disorders have been proposed as part of a new prognostic index for mantle cell lymphoma (MCL) known as MIPI-B-miR prognosticator [PMC6183594]. Furthermore, it has been associated with good prognosis in nasopharyngeal carcinoma (NPC) patients when downregulated [PMC6368411], indicating its diverse roles across different conditions.
guU U C U U ugaagca ugu AAGG GCAU UAG GCAGU AG g ||| |||| |||| ||| ||||| || aCG UUCC CGUA AUC CGUca uc c GUC C A C - uaagauu
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0001412 |
| Description | Homo sapiens hsa-miR-18b-5p mature miRNA |
| Sequence | 6 - UAAGGUGCAUCUAGUGCAGUUAG - 28 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004751 |
| Description | Homo sapiens hsa-miR-18b-3p mature miRNA |
| Sequence | 49 - UGCCCUAAAUGCCCCUUCUGGC - 70 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|