miRBase entry: mmu-mir-429

Stem-loop mmu-mir-429


Accession
MI0001642
Symbol
MGI: Mir429
Description
Mus musculus mmu-mir-429 precursor miRNA
Gene family
MIPF0000019; mir-8

Literature search
80 open access papers mention mmu-mir-429
(228 sentences)

Sequence

75684 reads, 420 reads per million, 92 experiments
ccugcugauggauGUCUUACCAGACAUGGUUAGAucuggaugcaucugucUAAUACUGUCUGGUAAUGCCGUccauccacggc
.(((..((((((((.(((((((((((..(((((((..(((....))))))))))..)))))))))).).))))))))..))).

Structure
c   cu        U -          UG       cu   u 
 cug  gauggauG C UUACCAGACA  GUUAGAu  gga g
 |||  |||||||| | ||||||||||  |||||||  |||  
 ggc  cuaccUGC G AAUGGUCUGU  UAAUcug  ucu c
c   ac        C U          CA       --   a 


Annotation confidence High
Do you think this miRNA is real?
Comments
Xie et al. [1] refer to this sequence by the internal identifier MIR201. The sequence is unrelated to mouse mir-201 (MIR:MI0000244).

Genome context
chr4: 156053905-156053987 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from mmu-mir-429
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-429-5p

Accession MIMAT0017178
Description Mus musculus mmu-miR-429-5p mature miRNA
Sequence 14 - GUCUUACCAGACAUGGUUAGA - 34
Evidence experimental
Illumina [4]
Database links
Predicted targets

Mature mmu-miR-429-3p

Accession MIMAT0001537
Description Mus musculus mmu-miR-429-3p mature miRNA
Sequence 51 - UAAUACUGUCUGGUAAUGCCGU - 72
Evidence experimental
cloned [2], Illumina [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 15735639
    Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals
    "Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M"
    "Nature (2005) 434:338-345