Stem-loop hcmv-mir-US25-1

Accession

MI0001684

Description

Human cytomegalovirus hcmv-mir-US25-1 precursor miRNA

Sequence

ugugAACCGCUCAGUGGCUCGGACCgccggcuguuucugcgcaccggUCCGAACGCUAGGUCGGUUCUca
((.((((((((.((((..((((((((...((.......))....)))))))).)))).)).)))))).))

Structure

  u      -  C    GC        -ccg  ug 
ug gAACCG CU AGUG  UCGGACCg    gc  u
|| |||||| || ||||  ||||||||    ||  u
ac CUUGGC GG UCGC  AGCCUggc    cg  u
  U      U  A    -A        cacg  uc 

Annotation confidence Not enough data

Genome context

HEHCMVCG: 215245-215314 [-]

Clustered miRNAs

4 other miRNAs are < 10 kb from hcmv-mir-US25-1

Disease association

hcmv-mir-US25-1 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hcmv-miR-US25-1-5p

• Accession: MIMAT0001581
• Description: Human cytomegalovirus hcmv-miR-US25-1-5p mature miRNA
• Sequence: 5 - AACCGCUCAGUGGCUCGGACC - 25
• Evidence: experimental ; cloned [1-3], Illumina [4-5]

Mature hcmv-miR-US25-1-3p

• Accession: MIMAT0004755
• Description: Human cytomegalovirus hcmv-miR-US25-1-3p mature miRNA
• Sequence: 48 - UCCGAACGCUAGGUCGGUUCU - 68
• Evidence: experimental ; cloned [3], Illumina [4-5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15782219
   Identification of microRNAs of the herpesvirus family
   "Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T"
   "Nat Methods (2005) 2:269-276


3. PubMed ID: 16207254
   Human cytomegalovirus expresses novel microRNAs during productive viral infection
   "Dunn W, Trang P, Zhong Q, Yang E, van Belle C, Liu F"
   "Cell Microbiol (2005) 7:1684-1695


4. PubMed ID: 22013051
   High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection
   "Stark TJ, Arnold JD, Spector DH, Yeo GW"
   "J Virol (2012) 86:226-235


5. PubMed ID: 22715351
   The microRNA Transcriptome of Human Cytomegalovirus (HCMV)
   "Meshesha MK, Veksler-Lublinsky I, Isakov O, Reichenstein I, Shomron N, Kedem K, Ziv-Ukelson M, Bentwich Z, Avni YS"
   "Open Virol J (2012) 6:38-48