Stem-loop osa-MIR437

Accession

MI0001688

Description

Oryza sativa osa-MIR437 precursor miRNA

Literature search

8 open access papers mention osa-MIR437
(14 sentences)

Sequence

107 reads, 74 reads per million, 2 experiments

cccucuguuucauauuguauuguguuuuaguuuuguuguaagucaaaauucuuuuacuuugaccaaguuuguaguaaaauaauuaacaucuaaaauaccaaauaaauacacuauugagacauauuucuugguugauuuuucuauaaacuuggucAAAGUUAGAGAAGUUUGACUUaggacaaaacuaaacaccuuaugauauggaacagaggg
(((((((((((((((((((..((((((.(((((((((.(((((((((.((((((.(((((((((((((((((((.(((((................(((((..(((((..((....))...))))).)))))..))))).))))))))))))))))))).)))))).))))))))).)))))))))))))))..)))))))))))))))))))

Structure

                   uu      u         g         a      u                   u     aauuaacaucuaaaau     au     -ca  a 
cccucuguuucauauugua  guguuu aguuuuguu uaagucaaa uucuuu acuuugaccaaguuuguag aaaau                accaa  aaaua   cu u
|||||||||||||||||||  |||||| ||||||||| ||||||||| |||||| ||||||||||||||||||| |||||                |||||  |||||   ||  
gggagacaagguauaguau  cacaaa ucaaaacag aUUCAGUUU AAGAGA UGAAAcugguucaaauauc uuuua                ugguu  uuuau   ga u
                   uc      -         g         G      U                   u     --------------gu     -c     aca  g 

Annotation confidence Not enough data

Genome context

Chr2: 17050336-17050548 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from osa-MIR437

Mature osa-miR437

• Accession: MIMAT0001586
• Description: Oryza sativa osa-miR437 mature miRNA
• Sequence: 155 - AAAGUUAGAGAAGUUUGACUU - 175
• Evidence: experimental ; cloned [1], Illumina [2]

References

1. PubMed ID: 19903869
   Rice MicroRNA effector complexes and targets
   "Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y"
   "Plant Cell (2009) 21:3421-3435


2. PubMed ID: 15805478
   Cloning and characterization of microRNAs from rice
   "Sunkar R, Girke T, Jain PK, Zhu JK"
   "Plant Cell (2005) 17:1397-1411